LXL04_037555 | RubberDandelionOmics

Gene overview

LXL04_037555

Reference: OH-1004 Chr: Chr09 Coordinates: 14091640-14102970 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2922 bp · LXL04_037555|LXL04_037555|OH1004|cDNA

ATGCCGACTGACGGAGATGATTATGCAACGATTGAATCCCAACTCGGGATAGCGAAGAGGGCAGATCGATTCCAGCGaaagaaagagaagaggGCAGATCGATTCGATCGATGCAGCGAGCAGCACACGtcggaagaaagaaagagaaggaGATCGAGGTTTCTCCCACCGTCGCGAGCAGCACACGAGCCGGCGAAGGGTTTCTCCCACCATCGCACACGAGCAGTACCGTCACTCTCTCCTATGGATCGGCTGTCGGc...

CDS

Download CDS FASTA

2922 bp · LXL04_037555|LXL04_037555|OH1004|CDS

ATGCCGACTGACGGAGATGATTATGCAACGATTGAATCCCAACTCGGGATAGCGAAGAGGGCAGATCGATTCCAGCGAAAGAAAGAGAAGAGGGCAGATCGATTCGATCGATGCAGCGAGCAGCACACGTCGGAAGAAAGAAAGAGAAGGAGATCGAGGTTTCTCCCACCGTCGCGAGCAGCACACGAGCCGGCGAAGGGTTTCTCCCACCATCGCACACGAGCAGTACCGTCACTCTCTCCTATGGATCGGCTGTCGGC...

Protein

Download Protein FASTA

973 aa · LXL04_037555|LXL04_037555|OH1004|PROTEIN

MPTDGDDYATIESQLGIAKRADRFQRKKEKRADRFDRCSEQHTSEERKRRRSRFLPPSRAAHEPAKGFSHHRTRAVPSLSPMDRLSAEERKRRGFLSRKKEKRTDGSCGFIHRGEGDCFGSVELLFFHKTPSPEVEAMILFLLLLFSLNIQSIFAVELTAISASKFLTEGDTLVSPAGLLELGFFRPGTSENKYVGIWYKKIPIQTVVWVANRNNPLSGDSTGTLKIVKTGNLVLVNETNDVVWSTNMTSSAVNAIATAN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_037555`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_037555

Location Chr09:14091640-14102970 (-)

Description Similar to At4g27290: G-type lectin S-receptor-like serine/threonine-protein kinase At4g27290

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g27290`	G-type lectin S-receptor-like serine/threonine-protein kinase At4g27290.	No verified direct reference in this release
`At4g21380`	Involved in the regulation of cellular expansion and differentiation.	No verified direct reference in this release
`At1g65790`	Involved in the regulation of cellular expansion and differentiation.	No verified direct reference in this release
`At1g65800`	Involved in the regulation of cellular expansion and differentiation.	No verified direct reference in this release
`At4g27300`	G-type lectin S-receptor-like serine/threonine-protein kinase SD1-1.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037555 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006468 protein phosphorylation Biological Process

GO:0006955 immune response Biological Process

GO:0007165 signal transduction Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0048544 recognition of pollen Biological Process

GO:0071215 cellular response to abscisic acid stimulus Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT1G65790

ath:AT1G65800

ath:AT4G21380

ath:AT4G27290

ath:AT4G27300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.843

Rank 1 · LXL04_037555 · OH-1004

Cytoplasm0.085

Rank 2 · LXL04_037555 · OH-1004

Endoplasmic reticulum0.083

Rank 3 · LXL04_037555 · OH-1004

Nucleus0.053

Rank 4 · LXL04_037555 · OH-1004

Extracellular0.025

Rank 5 · LXL04_037555 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01453.31B_lectin206-311 aa

PF00954.26S_locus_glycop343-446 aa

PF08276.18PAN_2475-542 aa

PF00069.32Pkinase642-905 aa

PF07714.24PK_Tyr_Ser-Thr643-909 aa

PF11883.14DUF3403912-953 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_037555	`PF01453.31`	B_lectin	206	311	2.3e-34	118.7
LXL04_037555	`PF00954.26`	S_locus_glycop	343	446	2e-25	90.2
LXL04_037555	`PF08276.18`	PAN_2	475	542	2.9e-21	76.0
LXL04_037555	`PF00069.32`	Pkinase	642	905	1.2e-42	146.8
LXL04_037555	`PF07714.24`	PK_Tyr_Ser-Thr	643	909	2.5e-46	158.8
LXL04_037555	`PF11883.14`	DUF3403	912	953	2.1e-06	28.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O81832`	Arabidopsis thaliana	G-type lectin S-receptor-like serine/threonine-protein kinase At4g27290	49.939%	Swiss-Prot	moderate database homology
`O81905`	Arabidopsis thaliana	Receptor-like serine/threonine-protein kinase SD1-8	48.642%	Swiss-Prot	moderate database homology
`Q39086`	Arabidopsis thaliana	Receptor-like serine/threonine-protein kinase SD1-7	47.317%	Swiss-Prot	moderate database homology
`Q9S972`	Arabidopsis thaliana	Receptor-like serine/threonine-protein kinase SD1-6	48.756%	Swiss-Prot	moderate database homology
`O81833`	Arabidopsis thaliana	G-type lectin S-receptor-like serine/threonine-protein kinase SD1-1	47.654%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card