LXL04_037353 | RubberDandelionOmics

Gene overview

LXL04_037353

Reference: OH-1004 Chr: Chr09 Coordinates: 7298157-7300582 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

957 bp · LXL04_037353|LXL04_037353|OH1004|cDNA

ATGCTTTTCAGCGCAACCTTCCCATCGGAGATTCAGAGGCTTGCGTCTGATTTTCTCTCCAACTACATATTTCTTTGCGTCAGAAGAGTCGGTTCCAGCACCGATTTGATTCTCCAAAAAGTCGTATTTGTCGAAGATATGGAAAAATGCGAGGTTTTAAGAAATCTTCGTCACGATCAGAAAGCTAACGGAAACCTTGGAAAGAATGCATTGGTTGTGATTTTTGTGGAGACGAAACGGGCTGCAGATACTTTGGAAAG...

CDS

Download CDS FASTA

957 bp · LXL04_037353|LXL04_037353|OH1004|CDS

ATGCTTTTCAGCGCAACCTTCCCATCGGAGATTCAGAGGCTTGCGTCTGATTTTCTCTCCAACTACATATTTCTTTGCGTCAGAAGAGTCGGTTCCAGCACCGATTTGATTCTCCAAAAAGTCGTATTTGTCGAAGATATGGAAAAATGCGAGGTTTTAAGAAATCTTCGTCACGATCAGAAAGCTAACGGAAACCTTGGAAAGAATGCATTGGTTGTGATTTTTGTGGAGACGAAACGGGCTGCAGATACTTTGGAAAG...

Protein

Download Protein FASTA

318 aa · LXL04_037353|LXL04_037353|OH1004|PROTEIN

MLFSATFPSEIQRLASDFLSNYIFLCVRRVGSSTDLILQKVVFVEDMEKCEVLRNLRHDQKANGNLGKNALVVIFVETKRAADTLESWLCRIGFPATAIHEIEGTKSDSGGELVLGGNSSKGLTSFPNYLVLHMRKFVMEAGWLPKKLGINIYLTTIVPVLSDFYHFDVYIDADDIIDISHMRSNADDIIDISHMRSKGLQPGQELLPKDALGGQEEPTKVLPNEDIVSQLAGMGFNYLHCQKAAINTSNVAVEKAMNWL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_037353`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_037353

Location Chr09:7298157-7300582 (+)

Description Similar to UBP14: Ubiquitin carboxyl-terminal hydrolase 14

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g20630`	Recognizes and hydrolyzes the peptide bond at the C-terminal Gly of ubiquitin.	The ubiquitin-specific protease UBP14 is essential for early embryo development in Arabidopsis thaliana.2001 · DOI: 10.1046/j.1365-313x.2001.01106.x
`At3g58570`	DEAD-box ATP-dependent RNA helicase 52.	No verified direct reference in this release
`At2g42520`	DEAD-box ATP-dependent RNA helicase 37.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0202100`	DEAD-box ATP-dependent RNA helicase 52B.	No verified direct reference in this release
`Os03g0805200`	DEAD-box ATP-dependent RNA helicase 37.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037353 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0009965 leaf morphogenesis Biological Process

GO:0016579 protein deubiquitination Biological Process

GO:0042127 regulation of cell population proliferation Biological Process

GO:0048767 root hair elongation Biological Process

GO:0071370 cellular response to gibberellin stimulus Biological Process

GO:0005634 nucleus Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT2G42520

ath:AT3G20630

ath:AT3G58570

dosa:Os03g0805200

dosa:Os07g0202100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.463

Rank 1 · LXL04_037353 · OH-1004

Nucleus0.348

Rank 2 · LXL04_037353 · OH-1004

Mitochondrion0.120

Rank 3 · LXL04_037353 · OH-1004

Endoplasmic reticulum0.107

Rank 4 · LXL04_037353 · OH-1004

Cell membrane0.072

Rank 5 · LXL04_037353 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00627.38UBA223-260 aa

PF22562.3UBA_7224-267 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_037353	`PF00627.38`	UBA	223	260	4.3e-06	27.2
LXL04_037353	`PF22562.3`	UBA_7	224	267	9.4e-16	58.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L6Y1`	Arabidopsis thaliana	Ubiquitin carboxyl-terminal hydrolase 14	56.757%	Swiss-Prot	weak database homology
`Q9M2F9`	Arabidopsis thaliana	DEAD-box ATP-dependent RNA helicase 52	64.348%	Swiss-Prot	weak database homology
`Q84W89`	Arabidopsis thaliana	DEAD-box ATP-dependent RNA helicase 37	60.870%	Swiss-Prot	weak database homology
`Q6Z4K6`	Oryza sativa subsp. japonica	DEAD-box ATP-dependent RNA helicase 52B	67.000%	Swiss-Prot	weak database homology
`Q75HJ0`	Oryza sativa subsp. japonica	DEAD-box ATP-dependent RNA helicase 37	67.000%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card