LXL04_037138 | RubberDandelionOmics

Gene overview

LXL04_037138

Reference: OH-1004 Chr: Chr08 Coordinates: 53876527-53882101 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3171 bp · LXL04_037138|LXL04_037138|OH1004|cDNA

ATGGCGCTCCCATCTCTGTCGCCCGCCAATAACCTTTCCTCTTCATCCTCCTATTCTGTTTCACCTTTCAGTTCCAAATTTCCCACTTGTCATCCCCAGCTCAATAGTTATTGCACTCGACATCTTTTACTATTAAGGGAATGCACCAGTAGCAGTAGCTTTCTTTTCCGGGGTGGAAAAAACAACTCGGCACACGGATATTACTATTCTTGCGTTCCAAGAGAGCGGAAGAAGACCACAGTGGCGGGGGCGTCATTAGG...

CDS

Download CDS FASTA

3171 bp · LXL04_037138|LXL04_037138|OH1004|CDS

ATGGCGCTCCCATCTCTGTCGCCCGCCAATAACCTTTCCTCTTCATCCTCCTATTCTGTTTCACCTTTCAGTTCCAAATTTCCCACTTGTCATCCCCAGCTCAATAGTTATTGCACTCGACATCTTTTACTATTAAGGGAATGCACCAGTAGCAGTAGCTTTCTTTTCCGGGGTGGAAAAAACAACTCGGCACACGGATATTACTATTCTTGCGTTCCAAGAGAGCGGAAGAAGACCACAGTGGCGGGGGCGTCATTAGG...

Protein

Download Protein FASTA

1056 aa · LXL04_037138|LXL04_037138|OH1004|PROTEIN

MALPSLSPANNLSSSSSYSVSPFSSKFPTCHPQLNSYCTRHLLLLRECTSSSSFLFRGGKNNSAHGYYYSCVPRERKKTTVAGASLGGLLGGIFKGGADTGESTRQQYSATVALINALESELMSLSDSELRDRTTLLKQRARQAPQSLDSILPEAFAIVREASKRVLGLRPFDVQLIGGMVLHKGEIAEMRTGEGKTLVAILPAYLNALSGKGVHVVTVNDYLARRDCEWVGQVARFLGLTVGLIQQNMTSEERRQNYLC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_037138`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_037138

Location Chr08:53876527-53882101 (+)

Description Similar to SECA1: Protein translocase subunit SECA1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g01800`	Has a central role in coupling the hydrolysis of ATP to the transfer of proteins across the thylakoid membrane.	Plastids contain a second sec translocase system with essential functions.2011 · DOI: 10.1104/pp.110.166546

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037138 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006605 protein targeting Biological Process

GO:0006886 intracellular protein transport Biological Process

GO:0009646 response to absence of light Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0010090 trichome morphogenesis Biological Process

GO:0010109 regulation of photosynthesis Biological Process

GO:0017038 protein import Biological Process

GO:0065002 intracellular protein transmembrane transport Biological Process

GO:0071806 protein transmembrane transport Biological Process

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

KEGG gene cross-reference

ag:CAA57798

ath:AT4G01800

olu:OSTLU_36933

tel:tll1851

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.942

Rank 1 · LXL04_037138 · OH-1004

Mitochondrion0.073

Rank 2 · LXL04_037138 · OH-1004

Cytoplasm0.036

Rank 3 · LXL04_037138 · OH-1004

Nucleus0.031

Rank 4 · LXL04_037138 · OH-1004

Peroxisome0.019

Rank 5 · LXL04_037138 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07517.21SecA_DEAD102-502 aa

PF01043.27SecA_PP_bind352-458 aa

PF21090.4P-loop_SecA517-806 aa

PF07516.19SecA_SW808-1023 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_037138	`PF07517.21`	SecA_DEAD	102	502	4.4e-121	404.3
LXL04_037138	`PF01043.27`	SecA_PP_bind	352	458	5.9e-38	130.5
LXL04_037138	`PF21090.4`	P-loop_SecA	517	806	9.8e-84	280.8
LXL04_037138	`PF07516.19`	SecA_SW	808	1023	1.1e-55	189.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SYI0`	Arabidopsis thaliana	Protein translocase subunit SECA1, chloroplastic	78.386%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card