Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2142 bp · LXL04_037132|LXL04_037132|OH1004|cDNA
ATGGACGATACCTGTGCTGTGTGTGCTGAGAGTCTAGAATGGGTTGCCTACGGATCTTGTGGACACAAGGAAGTTTGCTCTACATGCGTTGCTCGTCTTCGATTCATCTGTAGTGATCGCCGCTGCTGCATCTGCAAAACAGAGTCCAGTCTTATATTTGTTACCAAGGCTTTAGGGGACTACACTAAGATGGTAAATGACTTCTCGGTCTTCCCTTCCGAAGATAAAGAGGGTCGATCTGGCCCATATTGGTACCATGA...
2142 bp · LXL04_037132|LXL04_037132|OH1004|CDS
ATGGACGATACCTGTGCTGTGTGTGCTGAGAGTCTAGAATGGGTTGCCTACGGATCTTGTGGACACAAGGAAGTTTGCTCTACATGCGTTGCTCGTCTTCGATTCATCTGTAGTGATCGCCGCTGCTGCATCTGCAAAACAGAGTCCAGTCTTATATTTGTTACCAAGGCTTTAGGGGACTACACTAAGATGGTAAATGACTTCTCGGTCTTCCCTTCCGAAGATAAAGAGGGTCGATCTGGCCCATATTGGTACCATGA...
Protein
Download Protein FASTA713 aa · LXL04_037132|LXL04_037132|OH1004|PROTEIN
MDDTCAVCAESLEWVAYGSCGHKEVCSTCVARLRFICSDRRCCICKTESSLIFVTKALGDYTKMVNDFSVFPSEDKEGRSGPYWYHEDTQSYFDDLDQYKMIKAMCRLSCSVCDKVEENTSNTSKRRARFRDIHQLKGHLFHQHKLFMCSLCLEGRKVFICEQKLYSKAQLKQHINTGDSEVDGSESDRGGFQGHPLCEFCRSPFYGDNELYTHMSTEHYTCHICQRQNPGQYEYYKNYDDLEIHFRQEHFLCEDEACLG...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_037132 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_037132 |
|---|---|
| Location | Chr08:53781866-53785340 (+) |
| Description | Similar to SPCC1223.01: E3 ubiquitin-protein ligase hel2 (Schizosaccharomyces pombe (strain 972 / ATCC 24843) |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006417 regulation of translation Biological Process GO:0006513 protein monoubiquitination Biological Process GO:0010629 negative regulation of gene expression Biological Process GO:0016567 protein ubiquitination Biological Process GO:0036205 histone catabolic process Biological Process GO:0045947 negative regulation of translational initiation Biological Process GO:0061157 mRNA destabilization Biological Process GO:0070534 protein K63-linked ubiquitination Biological Process GO:0070651 nonfunctional rRNA decay Biological Process GO:0070966 nuclear-transcribed mRNA catabolic process, no-go decay Biological Process GO:0072344 rescue of stalled cytosolic ribosome Biological Process GO:1990116 ribosome-associated ubiquitin-dependent protein catabolic process Biological Process |
| KEGG gene cross-reference | dre:407728 hsa:90850 mmu:213753 sce:YDR266C spo:2539079 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF25447.2RING_ZNF5982-62 aaPF23230.1zf-C2H2_13219-275 aaPF23202.2PAH_ZNF598488-562 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_037132 | PF25447.2 | RING_ZNF598 | 2 | 62 | 1e-07 | 32.9 |
| LXL04_037132 | PF23230.1 | zf-C2H2_13 | 219 | 275 | 1.1e-16 | 61.4 |
| LXL04_037132 | PF23202.2 | PAH_ZNF598 | 488 | 562 | 9.8e-21 | 74.6 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.