LXL04_037093 | RubberDandelionOmics

Gene overview

LXL04_037093

Reference: OH-1004 Chr: Chr08 Coordinates: 53073028-53076086 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2196 bp · LXL04_037093|LXL04_037093|OH1004|cDNA

ATGGGCACAGAAAGGAAAAGGAAGGTGAGCTTGTTCGACGTCGTAGATGACGCCACAGCGACGGCCAAGGTTAACAAAGCAAACGGGGGAGCCGCCGTTCATGGTATCAACAATAGCACGGGAAGCATGACTGTGAACAGCTGGAATGGACGCCCTTACTCACAGCGTTATTTTGATATATTGGAGAAGAGAAAGACTCTGCCCGTTTGGCATCAGAAAGAGGAGTTTTTGAAAGTACTCAAAGAGAATCAGACGCTTAT...

CDS

Download CDS FASTA

2196 bp · LXL04_037093|LXL04_037093|OH1004|CDS

ATGGGCACAGAAAGGAAAAGGAAGGTGAGCTTGTTCGACGTCGTAGATGACGCCACAGCGACGGCCAAGGTTAACAAAGCAAACGGGGGAGCCGCCGTTCATGGTATCAACAATAGCACGGGAAGCATGACTGTGAACAGCTGGAATGGACGCCCTTACTCACAGCGTTATTTTGATATATTGGAGAAGAGAAAGACTCTGCCCGTTTGGCATCAGAAAGAGGAGTTTTTGAAAGTACTCAAAGAGAATCAGACGCTTAT...

Protein

Download Protein FASTA

731 aa · LXL04_037093|LXL04_037093|OH1004|PROTEIN

MGTERKRKVSLFDVVDDATATAKVNKANGGAAVHGINNSTGSMTVNSWNGRPYSQRYFDILEKRKTLPVWHQKEEFLKVLKENQTLILVGETGSGKTTQIPQFVLEAVEVESGDRRKKFMVGCTQPRRVAAMSVSRRVAEEMDVTIGEEVGYSIRFEDCSSAKTVLKYLTDGMLLREAMTDPLLERYKVIILDEAHERTLATDVLFGLLKEVLKNRADLKLVVMSATLEAEKFQGYFFGAPLMKVPGRLHPVEIFYTQEP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_037093`
TK1151 ID	TkA04G004040
OH-1004 ID	LXL04_037093
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_037093

Location Chr08:53073028-53076086 (-)

Description Similar to At3g62310: Probable pre-mRNA-splicing factor ATP-dependent RNA helicase DEAH2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g62310`	May be involved in pre-mRNA splicing.	No verified direct reference in this release
`At2g47250`	May be involved in pre-mRNA splicing.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037093 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0006397 mRNA processing Biological Process

GO:0008380 RNA splicing Biological Process

GO:0009636 response to toxic substance Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0043279 response to alkaloid Biological Process

GO:0045087 innate immune response Biological Process

GO:0051607 defense response to virus Biological Process

GO:0140374 antiviral innate immune response Biological Process

GO:1900745 positive regulation of p38MAPK cascade Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

KEGG gene cross-reference

ath:AT2G47250

ath:AT3G62310

dme:Dmel_CG11107

hsa:1665

pon:100174435

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.629

Rank 1 · LXL04_037093 · OH-1004

Cytoplasm0.375

Rank 2 · LXL04_037093 · OH-1004

Mitochondrion0.082

Rank 3 · LXL04_037093 · OH-1004

Cell membrane0.039

Rank 4 · LXL04_037093 · OH-1004

Endoplasmic reticulum0.026

Rank 5 · LXL04_037093 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00270.36DEAD73-229 aa

PF13245.13AAA_1980-219 aa

PF13401.13AAA_2283-224 aa

PF00271.38Helicase_C271-409 aa

PF04408.30WHD_HA2472-500 aa

PF21010.3HA2_C501-560 aa

PF07717.23OB_NTP_bind622-698 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_037093	`PF00270.36`	DEAD	73	229	3.2e-09	37.5
LXL04_037093	`PF13245.13`	AAA_19	80	219	4.2e-06	27.7
LXL04_037093	`PF13401.13`	AAA_22	83	224	1.3e-08	35.9
LXL04_037093	`PF00271.38`	Helicase_C	271	409	4.1e-09	37.4
LXL04_037093	`PF04408.30`	WHD_HA2	472	500	3.5e-11	43.5
LXL04_037093	`PF21010.3`	HA2_C	501	560	1.4e-15	58.3
LXL04_037093	`PF07717.23`	OB_NTP_bind	622	698	1.8e-24	86.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LZQ9`	Arabidopsis thaliana	Probable pre-mRNA-splicing factor ATP-dependent RNA helicase DEAH2	88.098%	Swiss-Prot	strong database homology
`O22899`	Arabidopsis thaliana	Probable pre-mRNA-splicing factor ATP-dependent RNA helicase DEAH3	86.457%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card