LXL04_037070 | RubberDandelionOmics

Gene overview

LXL04_037070

Reference: OH-1004 Chr: Chr08 Coordinates: 52564146-52567905 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2238 bp · LXL04_037070|LXL04_037070|OH1004|cDNA

ATGCTACACGAACTCCTACTCGCACTGTTAGGGTACACCGGAGACCTCATTATTGATGAGAGAGAACGCCGAGAATCCGTTGGTTTGTCTCCGGATGACTCCATTTCCGATCAATGTACGTTCAAGCTTGCTCCTGACATATCCTTCATTCAACCTGAGGAAAGGGATATCATTGAGAAGATAATCACATTGGGATTTTACTACCGTGAACTTGACCGATTTGCCACCAAATCCCGAAATTTAAGCTGGATAAGATCTGG...

CDS

Download CDS FASTA

2238 bp · LXL04_037070|LXL04_037070|OH1004|CDS

ATGCTACACGAACTCCTACTCGCACTGTTAGGGTACACCGGAGACCTCATTATTGATGAGAGAGAACGCCGAGAATCCGTTGGTTTGTCTCCGGATGACTCCATTTCCGATCAATGTACGTTCAAGCTTGCTCCTGACATATCCTTCATTCAACCTGAGGAAAGGGATATCATTGAGAAGATAATCACATTGGGATTTTACTACCGTGAACTTGACCGATTTGCCACCAAATCCCGAAATTTAAGCTGGATAAGATCTGG...

Protein

Download Protein FASTA

745 aa · LXL04_037070|LXL04_037070|OH1004|PROTEIN

MLHELLLALLGYTGDLIIDERERRESVGLSPDDSISDQCTFKLAPDISFIQPEERDIIEKIITLGFYYRELDRFATKSRNLSWIRSGNVSPLSRTSKISKDARDNQSVYRRAIANGIAEVLSIYRSAVLHIEQKLLSDSLPILATVTQGLNKFLFFFPPLYELILEIERDGICGGKLLTLLHKRCHCGVPEVQTCIQRLLWHGHQVMYNQLTHWMVYGILHDQYGEFFISRQHEKDLENESSSHSNKIQKMGKKSGGDGS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_037070`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_037070

Location Chr08:52564146-52567905 (-)

Description Similar to GCP4: Gamma-tubulin complex component 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g53760`	Gamma-tubulin complex is necessary for microtubule nucleation at the microtubule organizing centers (MTOCs).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037070 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000278 mitotic cell cycle Biological Process

GO:0007020 microtubule nucleation Biological Process

GO:0007058 spindle assembly involved in female meiosis II Biological Process

GO:0007112 male meiosis cytokinesis Biological Process

GO:0009624 response to nematode Biological Process

GO:0031122 cytoplasmic microtubule organization Biological Process

GO:0043622 cortical microtubule organization Biological Process

GO:0051225 spindle assembly Biological Process

GO:0051321 meiotic cell cycle Biological Process

GO:0065003 protein-containing complex assembly Biological Process

GO:0090221 mitotic spindle-templated microtubule nucleation Biological Process

GO:0000922 spindle pole Cellular Component

KEGG gene cross-reference

ath:AT3G53760

dme:Dmel_CG6176

hsa:27229

mmu:51885

mtr:11416818

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.548

Rank 1 · LXL04_037070 · OH-1004

Golgi apparatus0.256

Rank 2 · LXL04_037070 · OH-1004

Nucleus0.229

Rank 3 · LXL04_037070 · OH-1004

Lysosome / Vacuole0.145

Rank 4 · LXL04_037070 · OH-1004

Cell membrane0.115

Rank 5 · LXL04_037070 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17681.7GCP_N_terminal2-386 aa

PF04130.19GCP_C_terminal391-717 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_037070	`PF17681.7`	GCP_N_terminal	2	386	1.1e-43	150.6
LXL04_037070	`PF04130.19`	GCP_C_terminal	391	717	3.7e-58	198.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M350`	Arabidopsis thaliana	Gamma-tubulin complex component 4	66.263%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card