LXL04_036974 | RubberDandelionOmics

Gene overview

LXL04_036974

Reference: OH-1004 Chr: Chr08 Coordinates: 51063414-51064637 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1161 bp · LXL04_036974|LXL04_036974|OH1004|cDNA

ATGGCGGTGGAGATTAGTAAAATTACATTGGAGATATTTTCGAAGCTTGAGAAGAAATGGCTGTCGCACTGTGAAGGCAGTAAGAAGACAAGAGTGCTCAGCATTGATGGTGGTGGAACCACTGGGGTTGTCTCAGGAGCTTCGTTGATCCATCTCGAAGACCAGATCCAGGCAAAAACTGGTGATTCGAATGCTCGAATAGTCGATTTCTTCGATATTATTGCTGGAACCGGCATTGGCGCGCTTCTCGCTGTAATGCT...

CDS

Download CDS FASTA

1161 bp · LXL04_036974|LXL04_036974|OH1004|CDS

ATGGCGGTGGAGATTAGTAAAATTACATTGGAGATATTTTCGAAGCTTGAGAAGAAATGGCTGTCGCACTGTGAAGGCAGTAAGAAGACAAGAGTGCTCAGCATTGATGGTGGTGGAACCACTGGGGTTGTCTCAGGAGCTTCGTTGATCCATCTCGAAGACCAGATCCAGGCAAAAACTGGTGATTCGAATGCTCGAATAGTCGATTTCTTCGATATTATTGCTGGAACCGGCATTGGCGCGCTTCTCGCTGTAATGCT...

Protein

Download Protein FASTA

386 aa · LXL04_036974|LXL04_036974|OH1004|PROTEIN

MAVEISKITLEIFSKLEKKWLSHCEGSKKTRVLSIDGGGTTGVVSGASLIHLEDQIQAKTGDSNARIVDFFDIIAGTGIGALLAVMLNADDGNGRPLFTATDAVKFVNDRRKQLFKVKTVGVFRRRLVYSGKSMDKVLKEVLTRDDGKVLTLKDTCKPLLVPCFDLNSSAPFVFSRADASQSASYDFELWKVIRATSADPSMLKPFPLTSVDEKTSCLAIDGGIVMNNPSAIAVTHALHNKRDFPSLTGVENLVVISIGN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036974`
TK1151 ID	TkA04G013090
OH-1004 ID	LXL04_036974
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036974

Location Chr08:51063414-51064637 (+)

Description Similar to PLP9: Probable inactive patatin-like protein 9

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g63200`	Probable inactive patatin-like protein 9.	No verified direct reference in this release
`At3g54950`	Possesses non-specific lipolytic acyl hydrolase (LAH) activity.	No verified direct reference in this release
`At2g39220`	Possesses non-specific lipolytic acyl hydrolase (LAH) activity.	No verified direct reference in this release
`At4g29800`	Possesses non-specific lipolytic acyl hydrolase (LAH) activity.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0144500`	Possesses non-specific lipolytic acyl hydrolase (LAH) activity.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036974 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006644 phospholipid metabolic process Biological Process

GO:0006952 defense response Biological Process

GO:0016042 lipid catabolic process Biological Process

GO:0019374 galactolipid metabolic process Biological Process

GO:0051707 response to other organism Biological Process

GO:0005886 plasma membrane Cellular Component

GO:0004620 glycerophospholipase activity Molecular Function

GO:0016298 lipase activity Molecular Function

GO:0016787 hydrolase activity Molecular Function

GO:0047617 fatty acyl-CoA hydrolase activity Molecular Function

KEGG gene cross-reference

ath:AT2G39220

ath:AT3G54950

ath:AT3G63200

ath:AT4G29800

dosa:Os07g0144500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.437

Rank 1 · LXL04_036974 · OH-1004

Nucleus0.247

Rank 2 · LXL04_036974 · OH-1004

Mitochondrion0.162

Rank 3 · LXL04_036974 · OH-1004

Cell membrane0.161

Rank 4 · LXL04_036974 · OH-1004

Endoplasmic reticulum0.064

Rank 5 · LXL04_036974 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01734.28Patatin33-233 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036974	`PF01734.28`	Patatin	33	233	9.5e-18	65.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93ZQ3`	Arabidopsis thaliana	Probable inactive patatin-like protein 9	65.979%	Swiss-Prot	strong database homology
`Q9SV43`	Arabidopsis thaliana	Patatin-like protein 7	39.163%	Swiss-Prot	moderate database homology
`O80959`	Arabidopsis thaliana	Patatin-like protein 6	39.572%	Swiss-Prot	moderate database homology
`Q8H133`	Arabidopsis thaliana	Patatin-like protein 8	38.320%	Swiss-Prot	moderate database homology
`Q8H5D4`	Oryza sativa subsp. japonica	Patatin-like protein 3	37.221%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card