RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_036953
Reference: OH-1004 Chr: Chr08 Coordinates: 50829469-50832337 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1746 bp · LXL04_036953|LXL04_036953|OH1004|cDNA

ATGAGAGACGAAATCTTCACGAAAAGCAAGGTTTCATGGCCTAAAACACTCAAGAAATTGTTCAATGTCAAAAACAAAGCTCAAGATTTTCATGCGGATGatttcaatttcaatcatgGCGGTAGTTATGAAGGAAGGAAGAGCAATTTTTCAGAAAAAGAAATATGCACCATGAAGAAAAGCAGAAGAACAGAAAGTTGGAGAGAAAGATCGAGCAAAAGGACTGCTGATAGTCTTCGAGTAAATAAGCTCGATCTTGA...

CDS

Download CDS FASTA

1746 bp · LXL04_036953|LXL04_036953|OH1004|CDS

ATGAGAGACGAAATCTTCACGAAAAGCAAGGTTTCATGGCCTAAAACACTCAAGAAATTGTTCAATGTCAAAAACAAAGCTCAAGATTTTCATGCGGATGATTTCAATTTCAATCATGGCGGTAGTTATGAAGGAAGGAAGAGCAATTTTTCAGAAAAAGAAATATGCACCATGAAGAAAAGCAGAAGAACAGAAAGTTGGAGAGAAAGATCGAGCAAAAGGACTGCTGATAGTCTTCGAGTAAATAAGCTCGATCTTGA...

Protein

Download Protein FASTA

581 aa · LXL04_036953|LXL04_036953|OH1004|PROTEIN

MRDEIFTKSKVSWPKTLKKLFNVKNKAQDFHADDFNFNHGGSYEGRKSNFSEKEICTMKKSRRTESWRERSSKRTADSLRVNKLDLDRPQVTDVHNYRVFVATWNVAGKPPTSSLNLEDWLHTSPPADIYVLGFQEIVPLNAGNVLGTEDNGPAKKWLSLIRSTLNSLPVASDGYHFPSPVPDPIVELDSDFEGSVTQKPSSVPHRRSFQSLSRSMRMAESSYREIPHPGLDHRFSVSDRSMFGNRCSDFDQGVGSSDED...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_036953
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_036953
LocationChr08:50829469-50832337 (+)
DescriptionSimilar to IP5P4: Type I inositol polyphosphate 5-phosphatase 4
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g63240 Type I inositol polyphosphate 5-phosphatase 4. No verified direct reference in this release
At2g32010 Has phosphatase activity toward PtdIns(4,5)P₂ and, more weakly, PtdIns(3,4,5)P₃, but not Ins(1,4,5)P₃.
CVP2- and CVL1-mediated phosphoinositide signaling as a regulator of the ARF GAP SFC/VAN3 in establishment of foliar vein patterns.2009 · DOI: 10.1111/j.1365-313x.2009.03920.x
Primary root protophloem differentiation requires balanced phosphatidylinositol-4,5-biphosphate levels and systemically affects root branching.2015 · DOI: 10.1242/dev.118364
At1g05470 May have phosphatase activity toward PtdIns(4,5)P₂ and PtdIns(3,4,5)P₃.
Genetic regulation of vascular tissue patterning in Arabidopsis.1999 · DOI: 10.1105/tpc.11.11.2123
Cotyledon vascular pattern2-mediated inositol (1,4,5) triphosphate signal transduction is essential for closed venation patterns of Arabidopsis foliar organs.2004 · DOI: 10.1105/tpc.021030
CVP2- and CVL1-mediated phosphoinositide signaling as a regulator of the ARF GAP SFC/VAN3 in establishment of foliar vein patterns.2009 · DOI: 10.1111/j.1365-313x.2009.03920.x
Primary root protophloem differentiation requires balanced phosphatidylinositol-4,5-biphosphate levels and systemically affects root branching.2015 · DOI: 10.1242/dev.118364
At5g65090 May be involved in the regulation of root hairs development.
Genetic interactions during root hair morphogenesis in Arabidopsis.2000 · DOI: 10.1105/tpc.12.10.1961
Analysis of the root-hair morphogenesis transcriptome reveals the molecular identity of six genes with roles in root-hair development in Arabidopsis.2006 · DOI: 10.1111/j.1365-313x.2005.02609.x
At5g04980 Type I inositol polyphosphate 5-phosphatase 10. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_036953 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0009737 response to abscisic acid Biological Process
GO:0009738 abscisic acid-activated signaling pathway Biological Process
GO:0009932 cell tip growth Biological Process
GO:0010051 xylem and phloem pattern formation Biological Process
GO:0010053 root epidermal cell differentiation Biological Process
GO:0010067 procambium histogenesis Biological Process
GO:0010305 leaf vascular tissue pattern formation Biological Process
GO:0010588 cotyledon vascular tissue pattern formation Biological Process
GO:0030154 cell differentiation Biological Process
GO:0032957 inositol trisphosphate metabolic process Biological Process
GO:0046856 phosphatidylinositol dephosphorylation Biological Process
GO:0048765 root hair cell differentiation Biological Process
KEGG gene cross-reference
ath:AT1G05470
ath:AT2G32010
ath:AT3G63240
ath:AT5G65090
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.327
Rank 1 · LXL04_036953 · OH-1004
Nucleus0.272
Rank 2 · LXL04_036953 · OH-1004
Cell membrane0.264
Rank 3 · LXL04_036953 · OH-1004
Plastid0.131
Rank 4 · LXL04_036953 · OH-1004
Golgi apparatus0.076
Rank 5 · LXL04_036953 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22669.3Exo_endo_phos2103-170 aa
PF22669.3Exo_endo_phos2294-539 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_036953PF22669.3Exo_endo_phos21031705e-67227.2
LXL04_036953PF22669.3Exo_endo_phos22945395e-67227.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q8GTS0Arabidopsis thalianaType I inositol polyphosphate 5-phosphatase 461.473%Swiss-Protstrong database homology
Q0WQ41Arabidopsis thalianaType IV inositol polyphosphate 5-phosphatase 758.541%Swiss-Protstrong database homology
Q9LR47Arabidopsis thalianaType IV inositol polyphosphate 5-phosphatase 668.012%Swiss-Protmoderate database homology
Q66GQ6Arabidopsis thalianaType I inositol polyphosphate 5-phosphatase 543.725%Swiss-Protmoderate database homology
A8MR21Arabidopsis thalianaType I inositol polyphosphate 5-phosphatase 1044.111%Swiss-Protmoderate database homology

JBrowse

View in Genome Browser