LXL04_036936 | RubberDandelionOmics

Gene overview

LXL04_036936

Reference: OH-1004 Chr: Chr08 Coordinates: 50348150-50352355 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3567 bp · LXL04_036936|LXL04_036936|OH1004|cDNA

ATGGCAGTCCGCTTCAACCCCTGCGACACTCTCCTCATTCCATCCACCAACgccgccgccgccgccaccaccaccTCCGCTTTCATCTCCTCCAAAACAAAGTATTTCCCTTTCTCCTTATTCTCATTGAAGAAATCCAAAATCGCCCACAATTTCTCGTCACCTTCAACTCGCACACAGAATGTTTCCTCCGTCGTCTGCAGCTCTGCTAAGACCACCCAACCGACTCAAAATCAGAAACCAAATGTTGGTAAGCGAAC...

CDS

Download CDS FASTA

3567 bp · LXL04_036936|LXL04_036936|OH1004|CDS

ATGGCAGTCCGCTTCAACCCCTGCGACACTCTCCTCATTCCATCCACCAACGCCGCCGCCGCCGCCACCACCACCTCCGCTTTCATCTCCTCCAAAACAAAGTATTTCCCTTTCTCCTTATTCTCATTGAAGAAATCCAAAATCGCCCACAATTTCTCGTCACCTTCAACTCGCACACAGAATGTTTCCTCCGTCGTCTGCAGCTCTGCTAAGACCACCCAACCGACTCAAAATCAGAAACCAAATGTTGGTAAGCGAAC...

Protein

Download Protein FASTA

1188 aa · LXL04_036936|LXL04_036936|OH1004|PROTEIN

MAVRFNPCDTLLIPSTNAAAAATTTSAFISSKTKYFPFSLFSLKKSKIAHNFSSPSTRTQNVSSVVCSSAKTTQPTQNQKPNVGKRTDIKKIMILGAGPIVIGQACEFDYSGTQACKALRENGYEVVLINSNPATIMTDPEMADRTYIEPMTPELVEQVIAKERPDAILPTMGGQTALNLAVALAESGVLDKYNVELIGAKLEAIKKAEDRELFKQAMKNIGLKTPPSGIGTTLQECLQIANTIGEFPLIIRPAFTLGGS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036936`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036936

Location Chr08:50348150-50352355 (-)

Description Similar to CARB: Carbamoyl-phosphate synthase large chain, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g29900`	Large subunit of the arginine-specific carbamoyl phosphate synthase (CPSase).	Analysis of ven3 and ven6 reticulate mutants reveals the importance of arginine biosynthesis in Arabidopsis leaf development.2011 · DOI: 10.1111/j.1365-313x.2010.04425.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0570700`	Large subunit of the arginine-specific carbamoyl phosphate synthase (CPSase).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036936 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006221 pyrimidine nucleotide biosynthetic process Biological Process

GO:0006526 L-arginine biosynthetic process Biological Process

GO:0006541 glutamine metabolic process Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

GO:0044205 'de novo' UMP biosynthetic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005951 carbamoyl-phosphate synthase complex Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0004087 carbamoyl-phosphate synthase (ammonia) activity Molecular Function

GO:0004088 carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

afu:AF_1274

ana:alr3809

ath:AT1G29900

dosa:Os01g0570700

syn:sll0370

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.960

Rank 1 · LXL04_036936 · OH-1004

Cytoplasm0.049

Rank 2 · LXL04_036936 · OH-1004

Mitochondrion0.049

Rank 3 · LXL04_036936 · OH-1004

Peroxisome0.031

Rank 4 · LXL04_036936 · OH-1004

Nucleus0.024

Rank 5 · LXL04_036936 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25596.2CPSase_L_D189-206 aa

PF02786.23CPSase_L_D2210-417 aa

PF07478.19Dala_Dala_lig_C242-385 aa

PF02787.27CPSase_L_D3465-601 aa

PF25596.2CPSase_L_D1639-764 aa

PF02786.23CPSase_L_D2768-972 aa

PF02222.28ATP-grasp776-942 aa

PF07478.19Dala_Dala_lig_C796-940 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036936	`PF25596.2`	CPSase_L_D1	89	206	5.8e-100	330.1
LXL04_036936	`PF02786.23`	CPSase_L_D2	210	417	7.5e-112	372.7
LXL04_036936	`PF07478.19`	Dala_Dala_lig_C	242	385	1.3e-15	58.2
LXL04_036936	`PF02787.27`	CPSase_L_D3	465	601	1e-42	146.1
LXL04_036936	`PF25596.2`	CPSase_L_D1	639	764	5.8e-100	330.1
LXL04_036936	`PF02786.23`	CPSase_L_D2	768	972	7.5e-112	372.7
LXL04_036936	`PF02222.28`	ATP-grasp	776	942	2.3e-12	47.6
LXL04_036936	`PF07478.19`	Dala_Dala_lig_C	796	940	1.3e-15	58.2
LXL04_036936	`PF02142.28`	MGS	1055	1139	9.1e-20	71.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q42601`	Arabidopsis thaliana	Carbamoyl phosphate synthase arginine-specific large chain, chloroplastic	84.220%	Swiss-Prot	strong database homology
`B9EXM2`	Oryza sativa subsp. japonica	Carbamoyl phosphate synthase arginine-specific large chain, chloroplastic	81.935%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card