LXL04_036923 | RubberDandelionOmics

Gene overview

LXL04_036923

Reference: OH-1004 Chr: Chr08 Coordinates: 50142201-50144331 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

765 bp · LXL04_036923|LXL04_036923|OH1004|cDNA

ATGTTGGCTCGTCTCGCATCCAAACGGTTACTCGAGATCCGTCAAGCTTTCCATCAATCCCCTCAGACAGTTCGATCGTTATCCACTGCTCTAAACTATCATATTGATACTCCCGACAATAACTCTAAAGCTCCGTGGGAGTTTAACGAAGCTAACAAACCTAAGGTAAGTGAGATTTTATCTCACTATCCATCTAACTACAAGCAATCTGCAGTCATTCCACTGCTAGATCTTGCACAACAACAACATGGAGGTTGGCT...

CDS

Download CDS FASTA

765 bp · LXL04_036923|LXL04_036923|OH1004|CDS

ATGTTGGCTCGTCTCGCATCCAAACGGTTACTCGAGATCCGTCAAGCTTTCCATCAATCCCCTCAGACAGTTCGATCGTTATCCACTGCTCTAAACTATCATATTGATACTCCCGACAATAACTCTAAAGCTCCGTGGGAGTTTAACGAAGCTAACAAACCTAAGGTAAGTGAGATTTTATCTCACTATCCATCTAACTACAAGCAATCTGCAGTCATTCCACTGCTAGATCTTGCACAACAACAACATGGAGGTTGGCT...

Protein

Download Protein FASTA

254 aa · LXL04_036923|LXL04_036923|OH1004|PROTEIN

MLARLASKRLLEIRQAFHQSPQTVRSLSTALNYHIDTPDNNSKAPWEFNEANKPKVSEILSHYPSNYKQSAVIPLLDLAQQQHGGWLPVSAMDAVAKVVEVAPIRVYEVATFYSMFNRQKVGKYHLLVCGTTPCMIRGSRDIEDALLNHLGVKRNEVTKDGLFSVGEMECMGCCVNAPMITVADYSNGSEGYTYNYYEDVTPKRVVEIVEALKRGEKPPRGTQNPDRINCGPAGGNTTLLGEPKPPPCRDLDAC

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036923`
TK1151 ID	TkA04G017450
OH-1004 ID	LXL04_036923
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036923

Location Chr08:50142201-50144331 (+)

Description Similar to At4g02580: NADH dehydrogenase [ubiquinone] flavoprotein 2, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g02580`	Core subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I) that is believed to belong to the minimal assembly required for catalysis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036923 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006120 mitochondrial electron transport, NADH to ubiquinone Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0005829 cytosol Cellular Component

GO:0045271 respiratory chain complex I Cellular Component

GO:0003954 NADH dehydrogenase activity Molecular Function

GO:0008137 NADH dehydrogenase (ubiquinone) activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0016491 oxidoreductase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

GO:0051537 2 iron, 2 sulfur cluster binding Molecular Function

KEGG gene cross-reference

ath:AT4G02580

bta:282290

ggo:101146734

ptr:455295

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.959

Rank 1 · LXL04_036923 · OH-1004

Cytoplasm0.047

Rank 2 · LXL04_036923 · OH-1004

Nucleus0.043

Rank 3 · LXL04_036923 · OH-1004

Cell membrane0.023

Rank 4 · LXL04_036923 · OH-1004

Plastid0.012

Rank 5 · LXL04_036923 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01257.262Fe-2S_thioredx57-213 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036923	`PF01257.26`	2Fe-2S_thioredx	57	213	5.9e-51	172.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O22769`	Arabidopsis thaliana	NADH dehydrogenase [ubiquinone] flavoprotein 2, mitochondrial	84.706%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card