LXL04_036901 | RubberDandelionOmics

Gene overview

LXL04_036901

Reference: OH-1004 Chr: Chr08 Coordinates: 49922966-49934198 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5139 bp · LXL04_036901|LXL04_036901|OH1004|cDNA

ATGCAGGGTGCTACGACAAATATTATCGTAGGTTCCCCTGTATGGGTTGAAGACCTATCAGTTGCTTGGATTGATGGAGAAGTGTTAGGAATAAATGGAGAGGAAGCTGAGATACAAACTACTGATGGAAAGAAAGTTGTTGCGAATTTATCAAAAATATATTCCAAAGATGTGGAAGCTCCTGCTGGTGGAGTTGATGACATGACAAAGCTTTCTTATTTGCATGAGCCAGGAGTTTTGCAAAATTTAGCTACCAGATA...

CDS

Download CDS FASTA

5139 bp · LXL04_036901|LXL04_036901|OH1004|CDS

ATGCAGGGTGCTACGACAAATATTATCGTAGGTTCCCCTGTATGGGTTGAAGACCTATCAGTTGCTTGGATTGATGGAGAAGTGTTAGGAATAAATGGAGAGGAAGCTGAGATACAAACTACTGATGGAAAGAAAGTTGTTGCGAATTTATCAAAAATATATTCCAAAGATGTGGAAGCTCCTGCTGGTGGAGTTGATGACATGACAAAGCTTTCTTATTTGCATGAGCCAGGAGTTTTGCAAAATTTAGCTACCAGATA...

Protein

Download Protein FASTA

1712 aa · LXL04_036901|LXL04_036901|OH1004|PROTEIN

MQGATTNIIVGSPVWVEDLSVAWIDGEVLGINGEEAEIQTTDGKKVVANLSKIYSKDVEAPAGGVDDMTKLSYLHEPGVLQNLATRYQLNEIYTYTGNILIAVNPFKRLPHLYDDKMMQRYKGAAFGDLDPHVFAIAESAFRAMVNEGKSNSILVSGESGAGKTETTKMLMQYLAFLGGRKGTEGKRTVEQQILESNPVLEAFGNAKTVRNNNSSRFGKFVEIQFDKQGRISGAAIRTYLLERSRVCQISDPERNYHCFY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036901`
TK1151 ID	TkA04G018000
OH-1004 ID	LXL04_036901
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.400
Protein coverage (%)	TK1151 99.941 / OH-1004 99.883 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036901

Location Chr08:49922966-49934198 (-)

Description Similar to XI-A: Myosin-7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g04600`	Myosin heavy chain that is required for the cell cycle-regulated transport of various organelles and proteins for their segregation.	No verified direct reference in this release
`At1g08730`	Myosin heavy chain that is required for the cell cycle-regulated transport of various organelles and proteins for their segregation.	No verified direct reference in this release
`At1g54560`	Myosin heavy chain that is required for the cell cycle-regulated transport of various organelles and proteins for their segregation.	No verified direct reference in this release
`At5g20490`	Myosin heavy chain that is required for the cell cycle-regulated transport of various organelles and proteins for their segregation.	No verified direct reference in this release
`At2g33240`	Myosin heavy chain that is required for the cell cycle-regulated transport of various organelles and proteins for their segregation.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036901 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007015 actin filament organization Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0030048 actin filament-based movement Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0015629 actin cytoskeleton Cellular Component

GO:0016020 membrane Cellular Component

GO:0016459 myosin complex Cellular Component

GO:0000146 microfilament motor activity Molecular Function

GO:0003774 cytoskeletal motor activity Molecular Function

GO:0005516 calmodulin binding Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G04600

ath:AT1G08730

ath:AT1G54560

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.574

Rank 1 · LXL04_036901 · OH-1004

Cell membrane0.261

Rank 2 · LXL04_036901 · OH-1004

Nucleus0.173

Rank 3 · LXL04_036901 · OH-1004

Golgi apparatus0.121

Rank 4 · LXL04_036901 · OH-1004

Lysosome / Vacuole0.065

Rank 5 · LXL04_036901 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02736.27Myosin_N5-54 aa

PF00063.28Myosin_head65-727 aa

PF01843.26DIL1519-1623 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036901	`PF02736.27`	Myosin_N	5	54	1.1e-06	28.9
LXL04_036901	`PF00063.28`	Myosin_head	65	727	9.2e-257	854.4
LXL04_036901	`PF01843.26`	DIL	1519	1623	3e-28	98.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4I5Q6`	Arabidopsis thaliana	Myosin-7	50.170%	Swiss-Prot	strong database homology
`F4HXP9`	Arabidopsis thaliana	Myosin-9	71.272%	Swiss-Prot	moderate database homology
`F4HWY6`	Arabidopsis thaliana	Myosin-11	69.990%	Swiss-Prot	moderate database homology
`F4K5J1`	Arabidopsis thaliana	Myosin-17	66.350%	Swiss-Prot	moderate database homology
`F4IVR7`	Arabidopsis thaliana	Myosin-10	49.642%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card