LXL04_036896 | RubberDandelionOmics

Gene overview

LXL04_036896

Reference: OH-1004 Chr: Chr08 Coordinates: 49893499-49900202 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3021 bp · LXL04_036896|LXL04_036896|OH1004|cDNA

ATGGCGACTCCCCCGAAGCCATGGAAGGCGGAATATGCAAAATCGGGAAGATCTTCATGTAAAACCTGCAAGTCCCCCATCGCCCAAGAAAAACTCCGTCTTGGCAAGATGGTTCAAGCCACTCAATTCGACGGTTTCATGCCCGTAATCACCCATCCTCACCTCCCAATACTCTTCTTCTACTGTTTCTTGCTTAATCTATTCCATATTATAGATGTGGAACCATGCTACGTGCATATTGAAGAAGTCAAACCAAATAA...

CDS

Download CDS FASTA

3021 bp · LXL04_036896|LXL04_036896|OH1004|CDS

ATGGCGACTCCCCCGAAGCCATGGAAGGCGGAATATGCAAAATCGGGAAGATCTTCATGTAAAACCTGCAAGTCCCCCATCGCCCAAGAAAAACTCCGTCTTGGCAAGATGGTTCAAGCCACTCAATTCGACGGTTTCATGCCCGTAATCACCCATCCTCACCTCCCAATACTCTTCTTCTACTGTTTCTTGCTTAATCTATTCCATATTATAGATGTGGAACCATGCTACGTGCATATTGAAGAAGTCAAACCAAATAA...

Protein

Download Protein FASTA

1006 aa · LXL04_036896|LXL04_036896|OH1004|PROTEIN

MATPPKPWKAEYAKSGRSSCKTCKSPIAQEKLRLGKMVQATQFDGFMPVITHPHLPILFFYCFLLNLFHIIDVEPCYVHIEEVKPNKIVRVLNFSHCDDVEGIETLRWEDQQKIRQYVEGGGIGSKSTPTTPDVSKCTIEPSKTNRATCKICNEKIMTGEVRISSKAEGQGARGLSWHHAKCFLDSSPSTQLENLIGWESLSDSNKSTVLSLVKKSSATKKGKEEVKEEKETVKGSSKRKATVDRDQKSKIPKTEDDLLT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036896`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036896

Location Chr08:49893499-49900202 (-)

Description Similar to PARP1: Poly [ADP-ribose] polymerase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g31320`	Involved in the base excision repair (BER) pathway, by catalyzing the poly(ADP-ribosyl)ation of a limited number of acceptor proteins involved in chromatin architecture and in DNA metabolism.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0413700`	Involved in the base excision repair (BER) pathway, by catalyzing the poly(ADP-ribosyl)ation of a limited number of acceptor proteins involved in chromatin architecture and in DNA metabolism.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036896 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000012 single strand break repair Biological Process

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0000723 telomere maintenance Biological Process

GO:0006281 DNA repair Biological Process

GO:0006302 double-strand break repair Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006366 transcription by RNA polymerase II Biological Process

GO:0006974 DNA damage response Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0007005 mitochondrion organization Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0010332 response to gamma radiation Biological Process

KEGG gene cross-reference

ath:AT2G31320

bta:286764

dosa:Os07g0413700

hsa:142

zma:103647201

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.862

Rank 1 · LXL04_036896 · OH-1004

Cytoplasm0.208

Rank 2 · LXL04_036896 · OH-1004

Mitochondrion0.042

Rank 3 · LXL04_036896 · OH-1004

Cell membrane0.032

Rank 4 · LXL04_036896 · OH-1004

Endoplasmic reticulum0.019

Rank 5 · LXL04_036896 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00645.26zf-PARP11-48 aa

PF00645.26zf-PARP140-210 aa

PF21728.4PADR1_N271-327 aa

PF08063.18Zn_ribbon_PADR1328-369 aa

PF00533.34BRCT421-497 aa

PF16589.13BRCT_2433-506 aa

PF05406.21WGR550-628 aa

PF02877.20PARP_reg662-791 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036896	`PF00645.26`	zf-PARP	11	48	3.3e-28	99.0
LXL04_036896	`PF00645.26`	zf-PARP	140	210	3.3e-28	99.0
LXL04_036896	`PF21728.4`	PADR1_N	271	327	2e-23	83.2
LXL04_036896	`PF08063.18`	Zn_ribbon_PADR1	328	369	5.1e-17	62.1
LXL04_036896	`PF00533.34`	BRCT	421	497	1.5e-11	45.0
LXL04_036896	`PF16589.13`	BRCT_2	433	506	5.1e-07	30.7
LXL04_036896	`PF05406.21`	WGR	550	628	7.6e-18	65.1
LXL04_036896	`PF02877.20`	PARP_reg	662	791	2.8e-37	128.5
LXL04_036896	`PF00644.27`	PARP	805	1001	3.6e-79	265.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZP54`	Arabidopsis thaliana	Poly [ADP-ribose] polymerase 1	63.717%	Swiss-Prot	strong database homology
`Q7EYV7`	Oryza sativa subsp. japonica	Poly [ADP-ribose] polymerase 1	61.198%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card