LXL04_036716 | RubberDandelionOmics

Gene overview

LXL04_036716

Reference: OH-1004 Chr: Chr08 Coordinates: 46995484-46997543 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1149 bp · LXL04_036716|LXL04_036716|OH1004|cDNA

ATGGCGTCCATGGCAAAACCTATCCTTTCTTCGAATTTCATCCTTCCGACAACATCCCTTCACTTCAAAACAGCTCAAAAGGCACCATCTCTCCCTCTTCGGAGGAAGAGCAACTTTTCTGTACTGCGTGCAAGTTACGAGGTCGGGGGAGGTTACACGCAAGAGGAACTGGATGCAAGAGAAAAAGGCAGGAGCAAACCCCAAACGCCAGCTGACGACTCAAGTACTTGGAGTCCTGCTCAGTATGAAGCTCTCCTTAA...

CDS

Download CDS FASTA

1149 bp · LXL04_036716|LXL04_036716|OH1004|CDS

ATGGCGTCCATGGCAAAACCTATCCTTTCTTCGAATTTCATCCTTCCGACAACATCCCTTCACTTCAAAACAGCTCAAAAGGCACCATCTCTCCCTCTTCGGAGGAAGAGCAACTTTTCTGTACTGCGTGCAAGTTACGAGGTCGGGGGAGGTTACACGCAAGAGGAACTGGATGCAAGAGAAAAAGGCAGGAGCAAACCCCAAACGCCAGCTGACGACTCAAGTACTTGGAGTCCTGCTCAGTATGAAGCTCTCCTTAA...

Protein

Download Protein FASTA

382 aa · LXL04_036716|LXL04_036716|OH1004|PROTEIN

MASMAKPILSSNFILPTTSLHFKTAQKAPSLPLRRKSNFSVLRASYEVGGGYTQEELDAREKGRSKPQTPADDSSTWSPAQYEALLKGGEQVTSVLEEMANLLEDDQMDEESEELAVLIAAQGVIGKRVDQMESGFMMALDYMINLAEKDDDEKRKSLLEVIKETVLSHLTKKCPPHVQVVGLLCRTPRKESRHELLRRVAAGGGAFESENGAKVHLPGANLNDIANQADDLLETMESRPIVPDRKLLARLVLIREESRC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036716`
TK1151 ID	TkA04G027980
OH-1004 ID	LXL04_036716
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036716

Location Chr08:46995484-46997543 (-)

Description Similar to PRDA1: Protein PEP-RELATED DEVELOPMENT ARRESTED 1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g48470`	Plays an essential role in early steps of chloroplast development.	PRDA1, a novel chloroplast nucleoid protein, is required for early chloroplast development and is involved in the regulation of plastid gene expression in Arabidopsis.2013 · DOI: 10.1093/pcp/pct148

Rice

Reference gene ID	Possible function	Papers / DOI
`Os11g0425300`	Plays an essential role in early steps of chloroplast development.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036716 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0009507 chloroplast Cellular Component

GO:0042644 chloroplast nucleoid Cellular Component

KEGG gene cross-reference

ath:AT5G48470

dosa:Os11g0425300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.908

Rank 1 · LXL04_036716 · OH-1004

Nucleus0.065

Rank 2 · LXL04_036716 · OH-1004

Mitochondrion0.063

Rank 3 · LXL04_036716 · OH-1004

Cytoplasm0.028

Rank 4 · LXL04_036716 · OH-1004

Cell membrane0.021

Rank 5 · LXL04_036716 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF28651.1PRDA1_C178-309 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036716	`PF28651.1`	PRDA1_C	178	309	3.1e-63	212.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q1H5E9`	Arabidopsis thaliana	Protein PEP-RELATED DEVELOPMENT ARRESTED 1, chloroplastic	70.437%	Swiss-Prot	strong database homology
`Q53K52`	Oryza sativa subsp. japonica	Protein PEP-RELATED DEVELOPMENT ARRESTED 1 homolog, chloroplastic	69.207%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card