LXL04_036695 | RubberDandelionOmics

Gene overview

LXL04_036695

Reference: OH-1004 Chr: Chr08 Coordinates: 46739218-46741315 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

939 bp · LXL04_036695|LXL04_036695|OH1004|cDNA

ATGGCGCTGCACTTGTCGAAGCTGCCGTTATTTCGCCGTTGCGGGTGGCTTAGCTCCACCAATGGAGTCTTCTCCCCATCCGCACATCCAAACCTCTCTCACCAACCAGTTAGATGGCCGACCACTCCTCTCAGAAGCTTCGCCACTCTAAAATCAGGAAAAATCATACCACCAAAGAAAAAGAAGAGACTGGATGAAGTATGTCTAGAAAGATTCAACCAATACAGTCGAAACTACATCCAATCATGGATCCTACAAGG...

CDS

Download CDS FASTA

939 bp · LXL04_036695|LXL04_036695|OH1004|CDS

ATGGCGCTGCACTTGTCGAAGCTGCCGTTATTTCGCCGTTGCGGGTGGCTTAGCTCCACCAATGGAGTCTTCTCCCCATCCGCACATCCAAACCTCTCTCACCAACCAGTTAGATGGCCGACCACTCCTCTCAGAAGCTTCGCCACTCTAAAATCAGGAAAAATCATACCACCAAAGAAAAAGAAGAGACTGGATGAAGTATGTCTAGAAAGATTCAACCAATACAGTCGAAACTACATCCAATCATGGATCCTACAAGG...

Protein

Download Protein FASTA

312 aa · LXL04_036695|LXL04_036695|OH1004|PROTEIN

MALHLSKLPLFRRCGWLSSTNGVFSPSAHPNLSHQPVRWPTTPLRSFATLKSGKIIPPKKKKRLDEVCLERFNQYSRNYIQSWILQGKVIVDGKVVTKAGHPVSDKSIVEIKAEIPKYVCRAGHKLESAIEQLGIDVNGKVALDSGLSTGGFTDCLLQYGASFVYGVDVGYGQVAEKIRTDERVSIIERTNLRYLTELPQKVDLVTLDLSFISILLVMPAVVKLMKEEATLVTLIKPQFEARRSQVGGGGIVRDPLVHQE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036695`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_036695`
Location	Chr08:46739218-46741315 (-)
Description	Similar to tlyA: Hemolysin A
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_036695` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0000451 rRNA 2'-O-methylation Biological Process GO:0001897 symbiont-mediated cytolysis of host cell Biological Process GO:0006364 rRNA processing Biological Process GO:0016032 viral process Biological Process GO:0031167 rRNA methylation Biological Process GO:0031640 killing of cells of another organism Biological Process GO:0032259 methylation Biological Process GO:0042256 cytosolic ribosome assembly Biological Process GO:0048870 cell motility Biological Process GO:0071236 cellular response to antibiotic Biological Process GO:0005737 cytoplasm Cellular Component GO:0020002 host cell plasma membrane Cellular Component
KEGG gene cross-reference	bsu:BSU24260 cjj:CJJ81176_0616 mtc:MT1733 mtu:Rv1694 mtv:RVBD_1694 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.726

Rank 1 · LXL04_036695 · OH-1004

Plastid0.295

Rank 2 · LXL04_036695 · OH-1004

Cytoplasm0.060

Rank 3 · LXL04_036695 · OH-1004

Nucleus0.050

Rank 4 · LXL04_036695 · OH-1004

Extracellular0.010

Rank 5 · LXL04_036695 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01479.31S463-105 aa

PF01728.26FtsJ118-297 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036695	`PF01479.31`	S4	63	105	8e-11	42.2
LXL04_036695	`PF01728.26`	FtsJ	118	297	3.1e-37	129.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card