LXL04_035981 | RubberDandelionOmics

Gene overview

LXL04_035981

Reference: OH-1004 Chr: Chr08 Coordinates: 33415505-33417053 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1308 bp · LXL04_035981|LXL04_035981|OH1004|cDNA

ATGAACGTACTATTATTACTGGCATCACTCATTCATTTCTCAACGCTTTTTTATGGCCATTGTATCACTAATAACATTCAACTTGGTTCAGAAACTATGCTTAGTGTACCAGCCGGATTGTACATTACAGGTGTCGTTGAGCGAGCATTTGTTCTCGAGACCAGCCAGTCTGTGCCTAACTTTCGAGCTGGGCTTATCTTTGAAGCAACTGAAGACAAGTATGTTTGTTCGCTTGAAGTTTTTCTTGGGAATTTTAAAGT...

CDS

Download CDS FASTA

1308 bp · LXL04_035981|LXL04_035981|OH1004|CDS

ATGAACGTACTATTATTACTGGCATCACTCATTCATTTCTCAACGCTTTTTTATGGCCATTGTATCACTAATAACATTCAACTTGGTTCAGAAACTATGCTTAGTGTACCAGCCGGATTGTACATTACAGGTGTCGTTGAGCGAGCATTTGTTCTCGAGACCAGCCAGTCTGTGCCTAACTTTCGAGCTGGGCTTATCTTTGAAGCAACTGAAGACAAGTATGTTTGTTCGCTTGAAGTTTTTCTTGGGAATTTTAAAGT...

Protein

Download Protein FASTA

435 aa · LXL04_035981|LXL04_035981|OH1004|PROTEIN

MNVLLLLASLIHFSTLFYGHCITNNIQLGSETMLSVPAGLYITGVVERAFVLETSQSVPNFRAGLIFEATEDKYVCSLEVFLGNFKVWSSSHSSRFFTSQKCVLSLTRDGDLQLTGHNGVIGWRTATHGQGIERLQLSNTGNLVLVDKFDMIKWQSFHFPTNVMLWGQTLDVGTKLTSLPTNSNSFYSFEIHREKLALYLNSENFKYSYWEFIPTKSQKISFIRLASDGLQLINDDNHKIAQIPSKRLQLLRFLAVENTT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035981`
TK1151 ID	TkA04G088070
OH-1004 ID	LXL04_035981
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035981

Location Chr08:33415505-33417053 (+)

Description Similar to At1g78860: EP1-like glycoprotein 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g78860`	EP1-like glycoprotein 4.	No verified direct reference in this release
`At1g78850`	May be involved in a cell-to cell programmed cell death (PCD) signaling mechanism.	No verified direct reference in this release
`At5g03700`	PAN domain-containing protein At5g03700.	No verified direct reference in this release
`At1g78830`	EP1-like glycoprotein 2.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035981 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0048544 recognition of pollen Biological Process

GO:0051707 response to other organism Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:1904383 response to sodium phosphate Biological Process

GO:1990641 response to iron ion starvation Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005768 endosome Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005802 trans-Golgi network Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT1G78830

ath:AT1G78850

ath:AT1G78860

ath:AT5G03700

zma:542378

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.534

Rank 1 · LXL04_035981 · OH-1004

Extracellular0.268

Rank 2 · LXL04_035981 · OH-1004

Endoplasmic reticulum0.094

Rank 3 · LXL04_035981 · OH-1004

Cytoplasm0.085

Rank 4 · LXL04_035981 · OH-1004

Lysosome / Vacuole0.042

Rank 5 · LXL04_035981 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01453.31B_lectin96-173 aa

PF08277.19PAN_3326-389 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035981	`PF01453.31`	B_lectin	96	173	4.4e-11	43.9
LXL04_035981	`PF08277.19`	PAN_3	326	389	5.5e-06	26.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZVA5`	Arabidopsis thaliana	EP1-like glycoprotein 4	25.063%	Swiss-Prot	weak database homology
`Q9ZVA4`	Arabidopsis thaliana	EP1-like glycoprotein 3	25.000%	Swiss-Prot	weak database homology
`Q9LZR8`	Arabidopsis thaliana	PAN domain-containing protein At5g03700	24.722%	Swiss-Prot	weak database homology
`Q9ZVA2`	Arabidopsis thaliana	EP1-like glycoprotein 2	23.989%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card