LXL04_035899 | RubberDandelionOmics

Gene overview

LXL04_035899

Reference: OH-1004 Chr: Chr08 Coordinates: 31657929-31659801 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1332 bp · LXL04_035899|LXL04_035899|OH1004|cDNA

ATGGTGCGGTTGGGGAAACAAGATGGTGGCGGTGGcgctgctgctgctgctgctggTGGATATGGTGGTGGATTGGGCCTTGCGGCCGTAGCATACATCAGCGTGGACTATCTGCGACACATTTCGCCGTCGTGGCACGAGCTACTGCAGCCTTTGCTATGGATCGTACTCGCACTAATCGCAATTACACGCGTTCCGTTCTACAAGCACTGGTCAGCAGAGCTTCGATCAGCTCTAGTATTCATCGCCGCTTTGGTTTT...

CDS

Download CDS FASTA

1332 bp · LXL04_035899|LXL04_035899|OH1004|CDS

ATGGTGCGGTTGGGGAAACAAGATGGTGGCGGTGGCGCTGCTGCTGCTGCTGCTGGTGGATATGGTGGTGGATTGGGCCTTGCGGCCGTAGCATACATCAGCGTGGACTATCTGCGACACATTTCGCCGTCGTGGCACGAGCTACTGCAGCCTTTGCTATGGATCGTACTCGCACTAATCGCAATTACACGCGTTCCGTTCTACAAGCACTGGTCAGCAGAGCTTCGATCAGCTCTAGTATTCATCGCCGCTTTGGTTTT...

Protein

Download Protein FASTA

443 aa · LXL04_035899|LXL04_035899|OH1004|PROTEIN

MVRLGKQDGGGGAAAAAAGGYGGGLGLAAVAYISVDYLRHISPSWHELLQPLLWIVLALIAITRVPFYKHWSAELRSALVFIAALVFMLCTLLYEMISVRSVTAVLGLTWHRNTPPLPDTGQWILLGLNEKLPQVIVDILRARIVGLHHYLMLFVMLAFSVLFGSIEAPGLGIGARYMFTMAIGRFLRAISFASTILPSPRPWCAASRFDVPHHPHPWAQKFYVPYASDPKAINTVIHHDMAYDHVVVGDDEYRPNWGIM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035899`
TK1151 ID	TkA04G098080
OH-1004 ID	LXL04_035899
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	98.900
Protein coverage (%)	TK1151 100.000 / OH-1004 41.535 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035899

Location Chr08:31657929-31659801 (-)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g43580`	Catalyzes the biosynthesis of sphingolipids with very long-chain fatty acid (VLCFA).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035899 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009663 plasmodesma organization Biological Process

GO:0010497 plasmodesmata-mediated intercellular transport Biological Process

GO:0030148 sphingolipid biosynthetic process Biological Process

GO:0042761 very long-chain fatty acid biosynthetic process Biological Process

GO:0046513 ceramide biosynthetic process Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0033188 sphingomyelin synthase activity Molecular Function

GO:0047493 ceramide cholinephosphotransferase activity Molecular Function

KEGG gene cross-reference

ath:AT1G43580

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.535

Rank 1 · LXL04_035899 · OH-1004

Golgi apparatus0.357

Rank 2 · LXL04_035899 · OH-1004

Nucleus0.063

Rank 3 · LXL04_035899 · OH-1004

Cytoplasm0.058

Rank 4 · LXL04_035899 · OH-1004

Cell membrane0.043

Rank 5 · LXL04_035899 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14360.13PAP2_C287-354 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035899	`PF14360.13`	PAP2_C	287	354	6.5e-15	56.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XIG2`	Arabidopsis thaliana	Protein PHLOEM UNLOADING MODULATOR	62.085%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card