RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_035701
Reference: OH-1004 Chr: Chr08 Coordinates: 27411230-27419921 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

3171 bp · LXL04_035701|LXL04_035701|OH1004|cDNA

ATGGCCGAAACCCCAACACCGTTGCAGCTGTCGTCTCCGCCGCCGCATGCTGCCTCTGATAATCCCGATCCCGTACAATACTGGTGTTACCAGTGCGATAAACGAGTCCCCGTCGAAACCCGACCCGATGATCCAGATATCATCTGTTTTGAGTGTAAGAACGGATTTGTGGAGTCGATCTCAGTTCCTTCTCACGAACGAGAAGTCAGCGATGAAGATACTCCTGCTTTCGGGAACGAGTTTCTTCAGGTGCTTAGGTT...

CDS

Download CDS FASTA

3171 bp · LXL04_035701|LXL04_035701|OH1004|CDS

ATGGCCGAAACCCCAACACCGTTGCAGCTGTCGTCTCCGCCGCCGCATGCTGCCTCTGATAATCCCGATCCCGTACAATACTGGTGTTACCAGTGCGATAAACGAGTCCCCGTCGAAACCCGACCCGATGATCCAGATATCATCTGTTTTGAGTGTAAGAACGGATTTGTGGAGTCGATCTCAGTTCCTTCTCACGAACGAGAAGTCAGCGATGAAGATACTCCTGCTTTCGGGAACGAGTTTCTTCAGGTGCTTAGGTT...

Protein

Download Protein FASTA

1056 aa · LXL04_035701|LXL04_035701|OH1004|PROTEIN

MAETPTPLQLSSPPPHAASDNPDPVQYWCYQCDKRVPVETRPDDPDIICFECKNGFVESISVPSHEREVSDEDTPAFGNEFLQVLRLIAQSAREDDEPPPPPPAGHPVGDNDYLRIELDGWDNRILDVNEVEEEEDPQVDEGRARFYYDDDDEEDDDEQEEEEIENRNQEEEEVDEDIVRRERRDVLRLRLRDFASRASNRRNRILDWAEILMGLEDQSIEFRLQVPGDDDGYVGNPGDYVDAAGFEALLQNLAESDSSG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_035701
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_035701
LocationChr08:27411230-27419921 (+)
DescriptionSimilar to BIR2: Inactive LRR receptor-like serine/threonine-protein kinase BIR2
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g28450 Pseudokinases lacking protein kinase activity and unable to bind ATP-analogs.
Structure of the pseudokinase domain of BIR2, a regulator of BAK1-mediated immune signaling in Arabidopsis.2014 · DOI: 10.1016/j.jsb.2014.02.005
At5g48380 Probably inactive leucine-rich repeat receptor-like protein kinase At5g48380. No verified direct reference in this release
At1g69990 Probable LRR receptor-like serine/threonine-protein kinase At1g69990. No verified direct reference in this release
At1g27190 Probable inactive receptor kinase At1g27190. No verified direct reference in this release
At5g64920 E3 ubiquitin-protein ligase that mediates ubiquitination and subsequent proteasomal degradation of target proteins.
The RING finger motif of photomorphogenic repressor COP1 specifically interacts with the RING-H2 motif of a novel Arabidopsis protein.1999 · DOI: 10.1074/jbc.274.39.27674
Biochemical evidence for ubiquitin ligase activity of the Arabidopsis COP1 interacting protein 8 (CIP8).2002 · DOI: 10.1046/j.1365-313x.2002.01298.x

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_035701 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0006511 ubiquitin-dependent protein catabolic process Biological Process
GO:0006952 defense response Biological Process
GO:0009626 plant-type hypersensitive response Biological Process
GO:0016567 protein ubiquitination Biological Process
GO:0031348 negative regulation of defense response Biological Process
GO:0042742 defense response to bacterium Biological Process
GO:0045088 regulation of innate immune response Biological Process
GO:1900150 regulation of defense response to fungus Biological Process
GO:1900425 negative regulation of defense response to bacterium Biological Process
GO:0005576 extracellular region Cellular Component
GO:0005634 nucleus Cellular Component
GO:0005737 cytoplasm Cellular Component
KEGG gene cross-reference
ath:AT1G27190
ath:AT1G69990
ath:AT3G28450
ath:AT5G48380
ath:AT5G64920
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.644
Rank 1 · LXL04_035701 · OH-1004
Nucleus0.237
Rank 2 · LXL04_035701 · OH-1004
Cytoplasm0.194
Rank 3 · LXL04_035701 · OH-1004
Endoplasmic reticulum0.060
Rank 4 · LXL04_035701 · OH-1004
Plastid0.032
Rank 5 · LXL04_035701 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14369.12Zn_ribbon_1926-60 aa
PF12678.14zf-rbx1286-331 aa
PF13639.13zf-RING_2288-331 aa
PF13923.13zf-C3HC4_2288-330 aa
PF00097.32zf-C3HC4288-330 aa
PF08263.18LRRNT_2649-691 aa
PF07714.24PK_Tyr_Ser-Thr928-1035 aa
PF00069.32Pkinase939-1031 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_035701PF14369.12Zn_ribbon_1926603.3e-1143.8
LXL04_035701PF12678.14zf-rbx12863319.2e-0936.1
LXL04_035701PF13639.13zf-RING_22883311.4e-1145.2
LXL04_035701PF13923.13zf-C3HC4_22883307.1e-0832.8
LXL04_035701PF00097.32zf-C3HC42883302.2e-0628.1
LXL04_035701PF08263.18LRRNT_26496914.7e-0833.9
LXL04_035701PF07714.24PK_Tyr_Ser-Thr92810351.2e-0938.6
LXL04_035701PF00069.32Pkinase93910311.3e-1041.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9LSI9Arabidopsis thalianaInactive LRR receptor-like serine/threonine-protein kinase BIR234.308%Swiss-Protweak database homology
Q9ASS4Arabidopsis thalianaProbably inactive leucine-rich repeat receptor-like protein kinase At5g4838035.318%Swiss-Protweak database homology
C0LGI5Arabidopsis thalianaProbable LRR receptor-like serine/threonine-protein kinase At1g6999033.205%Swiss-Protweak database homology
O04567Arabidopsis thalianaProbable inactive receptor kinase At1g2719033.597%Swiss-Protweak database homology
Q9SPL2Arabidopsis thalianaE3 ubiquitin-protein ligase CIP863.226%Swiss-Protweak database homology

JBrowse

View in Genome Browser