LXL04_035681 | RubberDandelionOmics

Gene overview

LXL04_035681

Reference: OH-1004 Chr: Chr08 Coordinates: 26981918-26986897 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2694 bp · LXL04_035681|LXL04_035681|OH1004|cDNA

ATGGCGGTATTTTCTTCATCATTCGTGTCCCTTTACTCGCCGTGTCTTCATCAACGAACCAGTAATGCTCAGCTCACGAAATACTCTGTTCCGATTAGAACACACAACCGTAAATACACAATCGTAAGTGCCGGATCTGATATACGGAGGGAAGCAGTGGTCATAATCGGAGCTGGAATCGCCGGCCTCTCCACTGCTGTTTCGCTACACAGATTGGGGGTTCGTTCGGTGGTGCTGGAGCAAGCGGAATCGTTGCGGAC...

CDS

Download CDS FASTA

2694 bp · LXL04_035681|LXL04_035681|OH1004|CDS

ATGGCGGTATTTTCTTCATCATTCGTGTCCCTTTACTCGCCGTGTCTTCATCAACGAACCAGTAATGCTCAGCTCACGAAATACTCTGTTCCGATTAGAACACACAACCGTAAATACACAATCGTAAGTGCCGGATCTGATATACGGAGGGAAGCAGTGGTCATAATCGGAGCTGGAATCGCCGGCCTCTCCACTGCTGTTTCGCTACACAGATTGGGGGTTCGTTCGGTGGTGCTGGAGCAAGCGGAATCGTTGCGGAC...

Protein

Download Protein FASTA

897 aa · LXL04_035681|LXL04_035681|OH1004|PROTEIN

MAVFSSSFVSLYSPCLHQRTSNAQLTKYSVPIRTHNRKYTIVSAGSDIRREAVVIIGAGIAGLSTAVSLHRLGVRSVVLEQAESLRTGGTSLTLFKNGWKILDTMGVGDELRSQYLEIQGMVIRTETGRELRSFTFKEADQTQEVRAVERRTLLETLAKQLPAECISFSSKLQNIQKQEDGETLLELVNGTQIISKVVIGCDGIRSPLAKWMGFSEPKYVGYCAFRGLGEYPNGQPYESRVNYIYGRGVRAAYVPVSSTK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035681`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035681

Location Chr08:26981918-26986897 (-)

Description Similar to At1g76050: RNA pseudouridine synthase 2, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g76050`	RNA pseudouridine synthase 2, chloroplastic.	No verified direct reference in this release
`At4g38540`	Monooxygenase 2.	No verified direct reference in this release
`At5g05320`	Monooxygenase 3.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0717400`	RNA pseudouridine synthase 2, chloroplastic.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035681 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000455 enzyme-directed rRNA pseudouridine synthesis Biological Process

GO:0002239 response to oomycetes Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0004497 monooxygenase activity Molecular Function

GO:0009982 pseudouridine synthase activity Molecular Function

GO:0071949 FAD binding Molecular Function

GO:0120159 rRNA pseudouridine synthase activity Molecular Function

KEGG gene cross-reference

ath:AT1G76050

ath:AT4G38540

ath:AT5G05320

bsu:BSU15460

dosa:Os06g0717400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.923

Rank 1 · LXL04_035681 · OH-1004

Mitochondrion0.106

Rank 2 · LXL04_035681 · OH-1004

Cytoplasm0.025

Rank 3 · LXL04_035681 · OH-1004

Nucleus0.023

Rank 4 · LXL04_035681 · OH-1004

Peroxisome0.013

Rank 5 · LXL04_035681 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01494.26FAD_binding_352-388 aa

PF05834.19Lycopene_cycl53-228 aa

PF01266.31DAO53-91 aa

PF00849.28PseudoU_synth_2615-805 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035681	`PF01494.26`	FAD_binding_3	52	388	3e-25	89.9
LXL04_035681	`PF05834.19`	Lycopene_cycl	53	228	3.6e-07	30.3
LXL04_035681	`PF01266.31`	DAO	53	91	2.2e-06	28.2
LXL04_035681	`PF00849.28`	PseudoU_synth_2	615	805	6.8e-29	101.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q3ECD0`	Arabidopsis thaliana	RNA pseudouridine synthase 2, chloroplastic	68.407%	Swiss-Prot	weak database homology
`O81816`	Arabidopsis thaliana	Monooxygenase 2	34.988%	Swiss-Prot	weak database homology
`Q9FLC2`	Arabidopsis thaliana	Monooxygenase 3	33.002%	Swiss-Prot	weak database homology
`Q5Z8P2`	Oryza sativa subsp. japonica	RNA pseudouridine synthase 2, chloroplastic	61.600%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card