LXL04_035492 | RubberDandelionOmics

Gene overview

LXL04_035492

Reference: OH-1004 Chr: Chr08 Coordinates: 23541199-23545223 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2418 bp · LXL04_035492|LXL04_035492|OH1004|cDNA

ATGGGCGACGCCATGGTTGTTGACGTTCCAAAGAAATCGGCGAAGAGGAAGAGGGCTGAGTTGGTAATGAGTACAGAAGAAAGAGAAGCTCGCATTGAGGCTTTACGTGGGGAGCTTGATGGTCTGTTCAAGTATTACAACGAGTCTTTAAGTCGGAACATGTTGATTGATGTCGATTCCGTTAAGGCGAATGGTTTTAGTAACTCGTTGATTGCGTGTTTGCTGGAAGAGAGCAGTCTCCCCTTGTCTAAATTGGTGGA...

CDS

Download CDS FASTA

2418 bp · LXL04_035492|LXL04_035492|OH1004|CDS

ATGGGCGACGCCATGGTTGTTGACGTTCCAAAGAAATCGGCGAAGAGGAAGAGGGCTGAGTTGGTAATGAGTACAGAAGAAAGAGAAGCTCGCATTGAGGCTTTACGTGGGGAGCTTGATGGTCTGTTCAAGTATTACAACGAGTCTTTAAGTCGGAACATGTTGATTGATGTCGATTCCGTTAAGGCGAATGGTTTTAGTAACTCGTTGATTGCGTGTTTGCTGGAAGAGAGCAGTCTCCCCTTGTCTAAATTGGTGGA...

Protein

Download Protein FASTA

805 aa · LXL04_035492|LXL04_035492|OH1004|PROTEIN

MGDAMVVDVPKKSAKRKRAELVMSTEEREARIEALRGELDGLFKYYNESLSRNMLIDVDSVKANGFSNSLIACLLEESSLPLSKLVESIFDSVKEKEASLTPASVKSSVLLIGQRSFYGVQNPNADVLEDDSPSRLWCWETRDAKLLPKSIRGVLTEIMNPESPSNGVQKIMKASERLVKVLSEVEIRSLVDKMEQKNGADVAEKEVKREEKLVVKQLEKNKREVEKEKLRIERELLKEKLQNEKEMKRLQDEAEKEEKR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035492`
TK1151 ID	TkA04G127170
OH-1004 ID	LXL04_035492
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	94.300
Protein coverage (%)	TK1151 89.897 / OH-1004 51.553 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035492

Location Chr08:23541199-23545223 (+)

Description Similar to FAS1: Chromatin assembly factor 1 subunit FAS1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g65470`	Component of the chromatin assembly factor complex (CAF-1) involved in chromatin assembly following DNA replication and DNA repair.	FASCIATA genes for chromatin assembly factor-1 in arabidopsis maintain the cellular organization of apical meristems.2001 · DOI: 10.1016/s0092-8674(01)00197-0 The chromatin assembly factor subunit FASCIATA1 is involved in homologous recombination in plants.2006 · DOI: 10.1105/tpc.106.045088 Chromatin assembly factor CAF-1 is required for cellular differentiation during plant development.2006 · DOI: 10.1242/dev.02599 Increased frequency of homologous recombination and T-DNA integration in Arabidopsis CAF-1 mutants.2006 · DOI: 10.1038/sj.emboj.7601434 E2F regulates FASCIATA1, a chromatin assembly gene whose loss switches on the endocycle and activates gene expression by changing the epigenetic status.2007 · DOI: 10.1104/pp.106.094979 Dysfunction of chromatin assembly factor 1 induces shortening of telomeres and loss of 45S rDNA in Arabidopsis thaliana.2010 · DOI: 10.1105/tpc.110.076182

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0896300`	Component of the chromatin assembly factor complex (CAF-1) involved in chromatin assembly following DNA replication and DNA repair.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035492 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0006260 DNA replication Biological Process

GO:0006281 DNA repair Biological Process

GO:0006310 DNA recombination Biological Process

GO:0006325 chromatin organization Biological Process

GO:0006334 nucleosome assembly Biological Process

GO:0006335 DNA replication-dependent chromatin assembly Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0009555 pollen development Biological Process

GO:0009825 multidimensional cell growth Biological Process

GO:0009934 regulation of meristem structural organization Biological Process

GO:0010026 trichome differentiation Biological Process

KEGG gene cross-reference

ath:AT1G65470

bta:504535

dosa:Os01g0896300

gga:770217

hsa:10036

osa:4324973

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.939

Rank 1 · LXL04_035492 · OH-1004

Cytoplasm0.155

Rank 2 · LXL04_035492 · OH-1004

Cell membrane0.021

Rank 3 · LXL04_035492 · OH-1004

Mitochondrion0.019

Rank 4 · LXL04_035492 · OH-1004

Golgi apparatus0.009

Rank 5 · LXL04_035492 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12253.14CAF1A_dimeriz430-497 aa

PF21796.5Cac1_C653-703 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035492	`PF12253.14`	CAF1A_dimeriz	430	497	2.8e-20	73.0
LXL04_035492	`PF21796.5`	Cac1_C	653	703	1.8e-17	63.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SXY0`	Arabidopsis thaliana	Chromatin assembly factor 1 subunit FAS1	45.583%	Swiss-Prot	moderate database homology
`B2ZX90`	Oryza sativa subsp. japonica	Chromatin assembly factor 1 subunit FSM	37.559%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card