LXL04_035081 | RubberDandelionOmics

Gene overview

LXL04_035081

Reference: OH-1004 Chr: Chr08 Coordinates: 13674959-13677878 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1350 bp · LXL04_035081|LXL04_035081|OH1004|cDNA

ATGCTCTGCCTTTTCCCTTTCTTTGTTGTGGTGTTTCCTCTTCGGGCTCCGATTCCGACACATATTCGTTGTCGGATTCAATTTCTTCAAGTGGGGTTTGAGTTTGAGTTTGAGTTTGAGGTTGAGTTTGAGATGGATATTCCGAGGCAAATTGGTGTTGGAAATAATATTGGGATGATTGAGAGTGTTGTTGGGAGTGTTGAGATGATGGCGAATGAGGGTCGAAGGGTTGAAATTGTTGGTATTGgatttgttgttgt...

CDS

Download CDS FASTA

1350 bp · LXL04_035081|LXL04_035081|OH1004|CDS

ATGCTCTGCCTTTTCCCTTTCTTTGTTGTGGTGTTTCCTCTTCGGGCTCCGATTCCGACACATATTCGTTGTCGGATTCAATTTCTTCAAGTGGGGTTTGAGTTTGAGTTTGAGTTTGAGGTTGAGTTTGAGATGGATATTCCGAGGCAAATTGGTGTTGGAAATAATATTGGGATGATTGAGAGTGTTGTTGGGAGTGTTGAGATGATGGCGAATGAGGGTCGAAGGGTTGAAATTGTTGGTATTGGATTTGTTGTTGT...

Protein

Download Protein FASTA

449 aa · LXL04_035081|LXL04_035081|OH1004|PROTEIN

MLCLFPFFVVVFPLRAPIPTHIRCRIQFLQVGFEFEFEFEVEFEMDIPRQIGVGNNIGMIESVVGSVEMMANEGRRVEIVGIGFVVVVKDIAIVDLLMRKDCRLVLDLLLLLKILQLLISWCFFTKMGKISKADKKIAYDQKLCQLLDDYTQVLISAADNVGSNQLQNIRHGLRGDSVILMGKNTMMKRSIRMHSEKTGNTAYLNLIPLLVGNVGLIFTKGDLKEVSEEVAKYKVGAPARVGLVAPVDVVVPPGNTGLDP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035081`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035081

Location Chr08:13674959-13677878 (+)

Description Similar to 60S acidic ribosomal protein P0

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g11250`	Ribosomal protein P0 is the functional equivalent of E.coli protein L10.	No verified direct reference in this release
`At3g09200`	Ribosomal protein P0 is the functional equivalent of E.coli protein L10.	No verified direct reference in this release
`At2g40010`	Ribosomal protein P0 is the functional equivalent of E.coli protein L10.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0130500`	Ribosomal protein P0 is the functional equivalent of E.coli protein L10.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035081 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002181 cytoplasmic translation Biological Process

GO:0010043 response to zinc ion Biological Process

GO:0042254 ribosome biogenesis Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0046686 response to cadmium ion Biological Process

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0022625 cytosolic large ribosomal subunit Cellular Component

KEGG gene cross-reference

ath:AT2G40010

ath:AT3G09200

ath:AT3G11250

dosa:Os08g0130500

gmx:547816

osa:4344590

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.488

Rank 1 · LXL04_035081 · OH-1004

Nucleus0.179

Rank 2 · LXL04_035081 · OH-1004

Endoplasmic reticulum0.126

Rank 3 · LXL04_035081 · OH-1004

Mitochondrion0.125

Rank 4 · LXL04_035081 · OH-1004

Peroxisome0.110

Rank 5 · LXL04_035081 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00466.26Ribosomal_L10133-233 aa

PF17777.7RL10P_insert239-308 aa

PF00428.25Ribosomal_60s359-447 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035081	`PF00466.26`	Ribosomal_L10	133	233	1.5e-16	61.0
LXL04_035081	`PF17777.7`	RL10P_insert	239	308	1.1e-21	77.2
LXL04_035081	`PF00428.25`	Ribosomal_60s	359	447	3.2e-20	73.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P57691`	Arabidopsis thaliana	Large ribosomal subunit protein uL10x	79.257%	Swiss-Prot	strong database homology
`Q42112`	Arabidopsis thaliana	Large ribosomal subunit protein uL10y	85.560%	Swiss-Prot	moderate database homology
`O04204`	Arabidopsis thaliana	Large ribosomal subunit protein uL10z	75.701%	Swiss-Prot	strong database homology
`P41095`	Oryza sativa subsp. japonica	Large ribosomal subunit protein uL10	76.250%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card