LXL04_035076 | RubberDandelionOmics

Gene overview

LXL04_035076

Reference: OH-1004 Chr: Chr08 Coordinates: 13550712-13552741 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1341 bp · LXL04_035076|LXL04_035076|OH1004|cDNA

ATGATGTGGATGAACAGCAGGTTTGGTACAACAGTGAGGCACTTCTCTCGAGTGTCTCCTCCGCGAACTGACTGTGTAGTGCGGGTTTCATCTAACAacataactcatttgggtcgCCCTAAATCCAGTCACAAGCCTCGTCAGCTTTTATCCTTGCCCCCATTTCCACCTCATCCTCCACCTGGCAAGAATGGTCCTCCAGATTCTCGTATGACCGCCATTAGCTGGATAAAATACTACTTCGCTGATGTCACCGCGTC...

CDS

Download CDS FASTA

1341 bp · LXL04_035076|LXL04_035076|OH1004|CDS

ATGATGTGGATGAACAGCAGGTTTGGTACAACAGTGAGGCACTTCTCTCGAGTGTCTCCTCCGCGAACTGACTGTGTAGTGCGGGTTTCATCTAACAACATAACTCATTTGGGTCGCCCTAAATCCAGTCACAAGCCTCGTCAGCTTTTATCCTTGCCCCCATTTCCACCTCATCCTCCACCTGGCAAGAATGGTCCTCCAGATTCTCGTATGACCGCCATTAGCTGGATAAAATACTACTTCGCTGATGTCACCGCGTC...

Protein

Download Protein FASTA

446 aa · LXL04_035076|LXL04_035076|OH1004|PROTEIN

MMWMNSRFGTTVRHFSRVSPPRTDCVVRVSSNNITHLGRPKSSHKPRQLLSLPPFPPHPPPGKNGPPDSRMTAISWIKYYFADVTASLIQSHFNKGLVSIIFLSLEFEMLHIGFIIKHNEVMKSGCKIYVAVSVAESRISRRFDTIPTASLCPNADEIQYLQRLVMYKDSALLLLNKPPKVPLKGNVAVHNSMDALAAAALCYDYDEGPKLVHRLDRESSGIVLMGRTKETISYLHCLFSHMNTPLVACSDGCEPTTYQR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035076`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035076

Location Chr08:13550712-13552741 (-)

Description Similar to At1g78910: RNA pseudouridine synthase 3, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g78910`	RNA pseudouridine synthase 3, mitochondrial.	No verified direct reference in this release
`At3g19440`	RNA pseudouridine synthase 4, mitochondrial.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0520100`	RNA pseudouridine synthase 3, mitochondrial.	No verified direct reference in this release
`Os09g0103500`	RNA pseudouridine synthase 4, mitochondrial.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035076 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000455 enzyme-directed rRNA pseudouridine synthesis Biological Process

GO:0006397 mRNA processing Biological Process

GO:0008033 tRNA processing Biological Process

GO:0008380 RNA splicing Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0009982 pseudouridine synthase activity Molecular Function

GO:0106029 tRNA pseudouridine synthase activity Molecular Function

KEGG gene cross-reference

ath:AT1G78910

ath:AT3G19440

dosa:Os08g0520100

dosa:Os09g0103500

xtr:734064

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.746

Rank 1 · LXL04_035076 · OH-1004

Plastid0.116

Rank 2 · LXL04_035076 · OH-1004

Nucleus0.087

Rank 3 · LXL04_035076 · OH-1004

Cytoplasm0.074

Rank 4 · LXL04_035076 · OH-1004

Cell membrane0.015

Rank 5 · LXL04_035076 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00849.28PseudoU_synth_2172-338 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035076	`PF00849.28`	PseudoU_synth_2	172	338	9.5e-19	68.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q5XET6`	Arabidopsis thaliana	RNA pseudouridine synthase 3, mitochondrial	63.226%	Swiss-Prot	strong database homology
`Q9LT72`	Arabidopsis thaliana	RNA pseudouridine synthase 4, mitochondrial	37.324%	Swiss-Prot	moderate database homology
`Q0J4D4`	Oryza sativa subsp. japonica	RNA pseudouridine synthase 3, mitochondrial	59.598%	Swiss-Prot	strong database homology
`Q69K07`	Oryza sativa subsp. japonica	RNA pseudouridine synthase 4, mitochondrial	36.131%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card