LXL04_035044 | RubberDandelionOmics

Gene overview

LXL04_035044

Reference: OH-1004 Chr: Chr08 Coordinates: 12205843-12209658 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2157 bp · LXL04_035044|LXL04_035044|OH1004|cDNA

ATGCCGTTCATATCGCAAACGGAGAGACAATCCGATTACAATCTCATACCTTCAAGCTGCCCAATCGTTATCGACAATGGCGCCTCTTATTTTAGAATGGGATGGGCAGGAGAGAGTGAGCCTCGAATCATCTTTCGCAACATTGTTCAGAGGCCGCGCCACAAGATAACCGGGGAAACGGTGACAATTGTGGGTGACCATGATCCTGCTTTGTTAAAGTACTTTGATTGCACCCGTTCTGGACCACGTTCAGCATTTGA...

CDS

Download CDS FASTA

2157 bp · LXL04_035044|LXL04_035044|OH1004|CDS

ATGCCGTTCATATCGCAAACGGAGAGACAATCCGATTACAATCTCATACCTTCAAGCTGCCCAATCGTTATCGACAATGGCGCCTCTTATTTTAGAATGGGATGGGCAGGAGAGAGTGAGCCTCGAATCATCTTTCGCAACATTGTTCAGAGGCCGCGCCACAAGATAACCGGGGAAACGGTGACAATTGTGGGTGACCATGATCCTGCTTTGTTAAAGTACTTTGATTGCACCCGTTCTGGACCACGTTCAGCATTTGA...

Protein

Download Protein FASTA

718 aa · LXL04_035044|LXL04_035044|OH1004|PROTEIN

MPFISQTERQSDYNLIPSSCPIVIDNGASYFRMGWAGESEPRIIFRNIVQRPRHKITGETVTIVGDHDPALLKYFDCTRSGPRSAFDNDVVFQFEIMEYVLDFAFDRLGADESPINHPILITECACNPVQSRSKMAELLFETYGVPSIAFGVDAAFSYKYNQKLGICDRNGLAICSGFSTSHVIPFINGEPVYEACCRTNVGGYHVTDYLKQLLSLKYPHHMARLTWEKVEDLKMEHCYITLDYASEVRLFQKGGKEAEE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035044`
TK1151 ID	TkA04G175590
OH-1004 ID	LXL04_035044
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.800
Protein coverage (%)	TK1151 88.571 / OH-1004 56.128 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035044

Location Chr08:12205843-12209658 (+)

Description Similar to ARP5: Actin-related protein 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g12380`	Probable subunit of a chromatin-remodeling complex.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0144340`	Actin-related protein 5.	No verified direct reference in this release
`UniProt: A2WKK5`	Actin-related protein 5.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035044 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006281 DNA repair Biological Process

GO:0006310 DNA recombination Biological Process

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006974 DNA damage response Biological Process

GO:0010082 regulation of root meristem growth Biological Process

GO:0016192 vesicle-mediated transport Biological Process

GO:0030029 actin filament-based process Biological Process

GO:0045815 transcription initiation-coupled chromatin remodeling Biological Process

GO:0080036 regulation of cytokinin-activated signaling pathway Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT3G12380

ddi:DDB_G0291728

spo:2541031

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.776

Rank 1 · LXL04_035044 · OH-1004

Cytoplasm0.296

Rank 2 · LXL04_035044 · OH-1004

Mitochondrion0.030

Rank 3 · LXL04_035044 · OH-1004

Cell membrane0.025

Rank 4 · LXL04_035044 · OH-1004

Golgi apparatus0.015

Rank 5 · LXL04_035044 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00022.27Actin21-221 aa

PF00022.27Actin579-709 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035044	`PF00022.27`	Actin	21	221	2.4e-53	181.9
LXL04_035044	`PF00022.27`	Actin	579	709	2.4e-53	181.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q940Z2`	Arabidopsis thaliana	Actin-related protein 5	68.363%	Swiss-Prot	strong database homology
`A2ZP58`	Oryza sativa subsp. japonica	Actin-related protein 5	57.288%	Swiss-Prot	strong database homology
`A2WKK5`	Oryza sativa subsp. indica	Actin-related protein 5	57.288%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card