RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_034841
Reference: OH-1004 Chr: Chr08 Coordinates: 3981239-3985703 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1308 bp · LXL04_034841|LXL04_034841|OH1004|cDNA

ATGGCTGAAACACGTAGAAAAGCCCGATTAATTTGTCAAGACTCTCCAGGAGATGTTTTAATTTCAGCTGCTTTTGCTGCATTCAACGGTCCGGACATTTTTGGAGTGGGGGTGGATGGGGAAATTACTGAACCCATGATTAAAGAATTGGATGAGGACCGAGAAGAGTCCCAAGATCCTGAGCTTTTGCGAGACGATTTAAAGTCAAACCAGGAGCAGTTAGTCGCTGTTCTGAGTATTTTAATGCACTGCTGCAAAAT...

CDS

Download CDS FASTA

1308 bp · LXL04_034841|LXL04_034841|OH1004|CDS

ATGGCTGAAACACGTAGAAAAGCCCGATTAATTTGTCAAGACTCTCCAGGAGATGTTTTAATTTCAGCTGCTTTTGCTGCATTCAACGGTCCGGACATTTTTGGAGTGGGGGTGGATGGGGAAATTACTGAACCCATGATTAAAGAATTGGATGAGGACCGAGAAGAGTCCCAAGATCCTGAGCTTTTGCGAGACGATTTAAAGTCAAACCAGGAGCAGTTAGTCGCTGTTCTGAGTATTTTAATGCACTGCTGCAAAAT...

Protein

Download Protein FASTA

435 aa · LXL04_034841|LXL04_034841|OH1004|PROTEIN

MAETRRKARLICQDSPGDVLISAAFAAFNGPDIFGVGVDGEITEPMIKELDEDREESQDPELLRDDLKSNQEQLVAVLSILMHCCKIRGNRTALLKLGALSLLFEIACCTFSVEAIEPAEGILLIVESRDNINITQNALTVSNQQRNTEMVARILPYLTYGELAAMEALSFAFETSLRSFDSFDAERALRWDTWRLKSVSILPLLHALEWVAGDNEIGARAENLLDTISDKEGKGDGFLALLFPNEVYCTIQIRDQEASG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_034841
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_034841
LocationChr08:3981239-3985703 (-)
DescriptionSimilar to BIG: Auxin transport protein BIG
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g02260 Required for auxin efflux and polar auxin transport (PAT) influencing auxin-mediated developmental responses (e.g. cell elongation, apical dominance, lateral root production, inflorescence architecture, general growth and development).
BIG: a calossin-like protein required for polar auxin transport in Arabidopsis.2001 · DOI: 10.1101/gad.905201
Mutations in the huge Arabidopsis gene BIG affect a range of hormone and light responses.2003 · DOI: 10.1046/j.1365-313x.2003.01779.x
The auxin transport inhibitor response 3 (tir3) allele of BIG and auxin transport inhibitors affect the gibberellin status of Arabidopsis.2005 · DOI: 10.1111/j.1365-313x.2004.02287.x
CRM1/BIG-mediated auxin action regulates Arabidopsis inflorescence development.2007 · DOI: 10.1093/pcp/pcm094
Arabidopsis mutants define downstream branches in the phototransduction pathway.1994 · DOI: 10.1101/gad.8.3.339
Reduced naphthylphthalamic acid binding in the tir3 mutant of Arabidopsis is associated with a reduction in polar auxin transport and diverse morphological defects.1997 · DOI: 10.1105/tpc.9.5.745

Rice

Reference gene IDPossible functionPapers / DOI
Os09g0247700 Required for auxin efflux and polar auxin transport (PAT) influencing auxin-mediated developmental responses (e.g. cell elongation, apical dominance, lateral root production, inflorescence architecture, general growth and development) (By similarity). No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_034841 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0009620 response to fungus Biological Process
GO:0009640 photomorphogenesis Biological Process
GO:0009733 response to auxin Biological Process
GO:0009734 auxin-activated signaling pathway Biological Process
GO:0009826 unidimensional cell growth Biological Process
GO:0009926 auxin polar transport Biological Process
GO:0010311 lateral root formation Biological Process
GO:0048281 inflorescence morphogenesis Biological Process
GO:0048364 root development Biological Process
GO:0071596 ubiquitin-dependent protein catabolic process via the N-end rule pathway Biological Process
GO:0140455 cytoplasm protein quality control Biological Process
GO:0005737 cytoplasm Cellular Component
KEGG gene cross-reference
ath:AT3G02260
dosa:Os09g0247700
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.429
Rank 1 · LXL04_034841 · OH-1004
Cytoplasm0.422
Rank 2 · LXL04_034841 · OH-1004
Cell membrane0.107
Rank 3 · LXL04_034841 · OH-1004
Endoplasmic reticulum0.089
Rank 4 · LXL04_034841 · OH-1004
Mitochondrion0.081
Rank 5 · LXL04_034841 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30838.1UBR4_TPR66-128 aa
PF30838.1UBR4_TPR139-186 aa
PF30838.1UBR4_TPR199-233 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_034841PF30838.1UBR4_TPR661285.6e-35121.7
LXL04_034841PF30838.1UBR4_TPR1391865.6e-35121.7
LXL04_034841PF30838.1UBR4_TPR1992335.6e-35121.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9SRU2Arabidopsis thalianaAuxin transport protein BIG52.153%Swiss-Protweak database homology
B9G2A8Oryza sativa subsp. japonicaAuxin transport protein BIG46.411%Swiss-Protweak database homology

JBrowse

View in Genome Browser