LXL04_034312 | RubberDandelionOmics

Gene overview

LXL04_034312

Reference: OH-1004 Chr: Chr07 Coordinates: 96215439-96227305 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

8259 bp · LXL04_034312|LXL04_034312|OH1004|cDNA

ATGGAGGAAAATCAAGATTACTCCATCCGGGATCACAAGCTCTGTGGTTACTTGTGCGTTGTCCTCTCGATTTCCAATAATAACACTCAGAATCAGAGCGTCGACAATAGCATTACCAAAATCCCAATTGTCAACACTTCGTGTGATATTTTTCGAGATGGAACTGATGTCGGTTTTGTGTCGCCCGACGGATTTGTATTGTCCTTAATTAATTCAAGCTCCATCAACTCTAGTCCGACCGACGGGGAAGGCACGGAGAC...

CDS

Download CDS FASTA

8259 bp · LXL04_034312|LXL04_034312|OH1004|CDS

ATGGAGGAAAATCAAGATTACTCCATCCGGGATCACAAGCTCTGTGGTTACTTGTGCGTTGTCCTCTCGATTTCCAATAATAACACTCAGAATCAGAGCGTCGACAATAGCATTACCAAAATCCCAATTGTCAACACTTCGTGTGATATTTTTCGAGATGGAACTGATGTCGGTTTTGTGTCGCCCGACGGATTTGTATTGTCCTTAATTAATTCAAGCTCCATCAACTCTAGTCCGACCGACGGGGAAGGCACGGAGAC...

Protein

Download Protein FASTA

2752 aa · LXL04_034312|LXL04_034312|OH1004|PROTEIN

MEENQDYSIRDHKLCGYLCVVLSISNNNTQNQSVDNSITKIPIVNTSCDIFRDGTDVGFVSPDGFVLSLINSSSINSSPTDGEGTETPHKSKSECGGGSMGVSRKKLSKIGLVHGSVSVVHQLQALVNKKCMNITSRVVRIARNEESGEVRVVVLVDVYLPISLWSGWQFPRSRSTAAALFRHLSCDWKTRETILDYKKPDPTINTQIWNISDCHVLGCTHHCNSPDTSRNKLFDLHEIFKTLPSISTKGDFVISKLNPA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_034312`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_034312

Location Chr07:96215439-96227305 (-)

Description Similar to At3g54460: F-box protein At3g54460

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g54460`	F-box protein At3g54460.	No verified direct reference in this release
`At4g02960`	Retrovirus-related Pol polyprotein from transposon RE2.	No verified direct reference in this release
`UniProt: Q94HW2`	Retrovirus-related Pol polyprotein from transposon RE1.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_034312 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006281 DNA repair Biological Process

GO:0006310 DNA recombination Biological Process

GO:0006508 proteolysis Biological Process

GO:0015074 DNA integration Biological Process

GO:0071897 DNA biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0042575 DNA polymerase complex Cellular Component

GO:0003676 nucleic acid binding Molecular Function

GO:0003964 RNA-directed DNA polymerase activity Molecular Function

GO:0004190 aspartic-type endopeptidase activity Molecular Function

GO:0004386 helicase activity Molecular Function

KEGG gene cross-reference

ath:AT3G54460

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.638

Rank 1 · LXL04_034312 · OH-1004

Cytoplasm0.318

Rank 2 · LXL04_034312 · OH-1004

Mitochondrion0.067

Rank 3 · LXL04_034312 · OH-1004

Cell membrane0.040

Rank 4 · LXL04_034312 · OH-1004

Endoplasmic reticulum0.033

Rank 5 · LXL04_034312 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12937.13F-box-like270-303 aa

PF00176.30SNF2-rel_dom316-902 aa

PF07496.22zf-CW500-543 aa

PF14244.13Retrotran_gag_31025-1070 aa

PF14223.15Retrotran_gag_21051-1161 aa

PF22936.2Pol_BBD1361-1434 aa

PF13976.12gag_pre-integrs1481-1539 aa

PF00665.33rve1557-1653 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_034312	`PF12937.13`	F-box-like	270	303	6e-06	26.6
LXL04_034312	`PF00176.30`	SNF2-rel_dom	316	902	4.2e-61	207.3
LXL04_034312	`PF07496.22`	zf-CW	500	543	1.5e-13	51.2
LXL04_034312	`PF14244.13`	Retrotran_gag_3	1025	1070	3.1e-06	27.6
LXL04_034312	`PF14223.15`	Retrotran_gag_2	1051	1161	1.3e-07	32.3
LXL04_034312	`PF22936.2`	Pol_BBD	1361	1434	4.8e-20	72.4
LXL04_034312	`PF13976.12`	gag_pre-integrs	1481	1539	1.1e-15	57.9
LXL04_034312	`PF00665.33`	rve	1557	1653	1.5e-12	48.4
LXL04_034312	`PF25597.2`	SH3_retrovirus	1732	1792	7.2e-25	87.3
LXL04_034312	`PF07727.20`	RVT_2	2003	2247	3e-79	266.8
LXL04_034312	`PF00271.38`	Helicase_C	2583	2682	6.1e-11	43.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M1I1`	Arabidopsis thaliana	F-box protein At3g54460	50.000%	Swiss-Prot	weak database homology
`Q9ZT94`	Arabidopsis thaliana	Retrovirus-related Pol polyprotein from transposon RE2	44.148%	Swiss-Prot	weak database homology
`Q94HW2`	Arabidopsis thaliana	Retrovirus-related Pol polyprotein from transposon RE1	44.332%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card