LXL04_033814 | RubberDandelionOmics

Gene overview

LXL04_033814

Reference: OH-1004 Chr: Chr07 Coordinates: 59036499-59041754 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1050 bp · LXL04_033814|LXL04_033814|OH1004|cDNA

ATGGCTCTGTTTAAATTTTCATCTATCATCGCCACTTCAGAAAACATACTAAGGGCACATCCTTGTGAGTTTCGCTTTCTAAGAGCTGCGAGACCTCTTttgtctgcgccgcgcagaccACGCATAGACATAAGAGTTTGCAgtgtgtttgttttttggaagTGTGAAGAGGTAAAAACCTCTTCCCTTGctatctctttctctcctctcctCCATCGCGATTCAACAGGCACCAATCTCATCTCGCCTCTTCATCACCA...

CDS

Download CDS FASTA

1050 bp · LXL04_033814|LXL04_033814|OH1004|CDS

ATGGCTCTGTTTAAATTTTCATCTATCATCGCCACTTCAGAAAACATACTAAGGGCACATCCTTGTGAGTTTCGCTTTCTAAGAGCTGCGAGACCTCTTTTGTCTGCGCCGCGCAGACCACGCATAGACATAAGAGTTTGCAGTGTGTTTGTTTTTTGGAAGTGTGAAGAGGTAAAAACCTCTTCCCTTGCTATCTCTTTCTCTCCTCTCCTCCATCGCGATTCAACAGGCACCAATCTCATCTCGCCTCTTCATCACCA...

Protein

Download Protein FASTA

349 aa · LXL04_033814|LXL04_033814|OH1004|PROTEIN

MALFKFSSIIATSENILRAHPCEFRFLRAARPLLSAPRRPRIDIRVCSVFVFWKCEEVKTSSLAISFSPLLHRDSTGTNLISPLHHHRRRSSVAIKPSSSALHQADFSRELLPQTVDFKQFLPISVASFSHKPSISSNFKPQQSRASATVPLTGSITRKPSAITMLQRIATGIFISSVSMVVAAVIATKRLNTAREYGLLDDPNARIPMKIWWLLPQYLLAELVMFSPWLLCRSYFMKEACKPVDDDEVEVPMRGSVADC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_033814`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_033814

Location Chr07:59036499-59041754 (-)

Description Similar to NPF5.10: Protein NRT1/ PTR FAMILY 5.10

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g22540`	Protein NRT1/ PTR FAMILY 5.10.	No verified direct reference in this release
`At1g22550`	Protein NRT1/ PTR FAMILY 5.16.	No verified direct reference in this release
`At1g72140`	Protein NRT1/ PTR FAMILY 5.12.	No verified direct reference in this release
`At1g72120`	Protein NRT1/ PTR FAMILY 5.14.	No verified direct reference in this release
`At1g72125`	Protein NRT1/ PTR FAMILY 5.13.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033814 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009624 response to nematode Biological Process

GO:0015706 nitrate transmembrane transport Biological Process

GO:0055085 transmembrane transport Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0009705 plant-type vacuole membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0022857 transmembrane transporter activity Molecular Function

GO:0042937 tripeptide transmembrane transporter activity Molecular Function

GO:0071916 dipeptide transmembrane transporter activity Molecular Function

GO:0080054 low-affinity nitrate transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G22540

ath:AT1G22550

ath:AT1G72120

ath:AT1G72125

ath:AT1G72140

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.719

Rank 1 · LXL04_033814 · OH-1004

Nucleus0.150

Rank 2 · LXL04_033814 · OH-1004

Mitochondrion0.115

Rank 3 · LXL04_033814 · OH-1004

Cytoplasm0.065

Rank 4 · LXL04_033814 · OH-1004

Cell membrane0.043

Rank 5 · LXL04_033814 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00854.28PTR2158-223 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_033814	`PF00854.28`	PTR2	158	223	5.8e-11	42.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WP01`	Arabidopsis thaliana	Protein NRT1/ PTR FAMILY 5.10	59.155%	Swiss-Prot	weak database homology
`Q9SK96`	Arabidopsis thaliana	Protein NRT1/ PTR FAMILY 5.16	58.667%	Swiss-Prot	weak database homology
`Q9C7U1`	Arabidopsis thaliana	Protein NRT1/ PTR FAMILY 5.12	60.563%	Swiss-Prot	weak database homology
`Q8VZE2`	Arabidopsis thaliana	Protein NRT1/ PTR FAMILY 5.14	55.405%	Swiss-Prot	weak database homology
`Q0WSZ6`	Arabidopsis thaliana	Protein NRT1/ PTR FAMILY 5.13	54.054%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card