LXL04_033596 | RubberDandelionOmics

Gene overview

LXL04_033596

Reference: OH-1004 Chr: Chr07 Coordinates: 48765922-48768799 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1491 bp · LXL04_033596|LXL04_033596|OH1004|cDNA

ATGGATAACGAAATTCAACGGAAGCTACTTAGACATAGCGACGAAGAAACCGACGGCGACTTGAAAGAGAAGGTATGGACAGAATCCAAGAAGATATGGAGGGTTGCGTTGCCCAGTATGATATCCAGGGTTTGCGCATTCGGAACTCTCGTCATCACTCAATCATTCATCGGCCATATAAGCAACGTTGATCTCGCCGGCTACGCGCTCGTCCAAACCCTAAGTGTCCGATTTGTCAATGGAATACTTGTAAATCATCC...

CDS

Download CDS FASTA

1491 bp · LXL04_033596|LXL04_033596|OH1004|CDS

ATGGATAACGAAATTCAACGGAAGCTACTTAGACATAGCGACGAAGAAACCGACGGCGACTTGAAAGAGAAGGTATGGACAGAATCCAAGAAGATATGGAGGGTTGCGTTGCCCAGTATGATATCCAGGGTTTGCGCATTCGGAACTCTCGTCATCACTCAATCATTCATCGGCCATATAAGCAACGTTGATCTCGCCGGCTACGCGCTCGTCCAAACCCTAAGTGTCCGATTTGTCAATGGAATACTTGTAAATCATCC...

Protein

Download Protein FASTA

496 aa · LXL04_033596|LXL04_033596|OH1004|PROTEIN

MDNEIQRKLLRHSDEETDGDLKEKVWTESKKIWRVALPSMISRVCAFGTLVITQSFIGHISNVDLAGYALVQTLSVRFVNGILVNHPSFTSSLYTLGMSSATETLCGQAFGAGQHHMMGIYLQRSWIIDLITLSILLPVFIFGTQLYRLLGEDEAIAVSGGYISLWFIPFIYNFVFTLTIQMFLQAQLKNMVIAWLSIFRIAIHIPLSWLLAFKLNFGVAGAMFALSVSSWFLVIAEFVYIFGGWCPRSWKGFTIAAFKD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_033596`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_033596

Location Chr07:48765922-48768799 (+)

Description Similar to DTX25: Protein DETOXIFICATION 25

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g17700`	Protein DETOXIFICATION 25.	No verified direct reference in this release
`At3g03620`	Protein DETOXIFICATION 24.	No verified direct reference in this release
`At1g33110`	Protein DETOXIFICATION 21.	No verified direct reference in this release
`At1g33100`	Protein DETOXIFICATION 20.	No verified direct reference in this release
`At1g33080`	Protein DETOXIFICATION 23.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033596 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:1990961 xenobiotic detoxification by transmembrane export across the plasma membrane Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0015297 antiporter activity Molecular Function

GO:0022857 transmembrane transporter activity Molecular Function

GO:0042910 xenobiotic transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G33080

ath:AT1G33100

ath:AT1G33110

ath:AT3G03620

ath:AT5G17700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.361

Rank 1 · LXL04_033596 · OH-1004

Cell membrane0.360

Rank 2 · LXL04_033596 · OH-1004

Endoplasmic reticulum0.142

Rank 3 · LXL04_033596 · OH-1004

Cytoplasm0.078

Rank 4 · LXL04_033596 · OH-1004

Golgi apparatus0.076

Rank 5 · LXL04_033596 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01554.24MatE38-210 aa

PF01554.24MatE272-432 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_033596	`PF01554.24`	MatE	38	210	5.9e-42	143.8
LXL04_033596	`PF01554.24`	MatE	272	432	5.9e-42	143.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L616`	Arabidopsis thaliana	Protein DETOXIFICATION 25	49.378%	Swiss-Prot	moderate database homology
`F4J158`	Arabidopsis thaliana	Protein DETOXIFICATION 24	48.156%	Swiss-Prot	moderate database homology
`Q8W488`	Arabidopsis thaliana	Protein DETOXIFICATION 21	50.102%	Swiss-Prot	strong database homology
`F4HPH2`	Arabidopsis thaliana	Protein DETOXIFICATION 20	48.185%	Swiss-Prot	moderate database homology
`Q8RXK1`	Arabidopsis thaliana	Protein DETOXIFICATION 23	48.290%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card