LXL04_033416 | RubberDandelionOmics

Gene overview

LXL04_033416

Reference: OH-1004 Chr: Chr07 Coordinates: 43328642-43331292 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1752 bp · LXL04_033416|LXL04_033416|OH1004|cDNA

ATGGCTCAAGAAccctcttcttcttcccaaaCCCTAGAATCTTCAATCAGCCATGAAGATCTTCAGCAACCAGCTTCTTCTGTTACTTCAAGTTCTAGTGATACAAACAACCCAACTCTCACGCGTAACGTATCCTCCAGTCGCCTCAACGCTAAGGCTCCGGAATTTGTTCCTCGAACTAGTACCGCCGCATCCTCGCCGTCTTCAGCCTCTACTACGACTGCCACTACTGTCACTAGTCGCCCCGATCTATCTCAGCC...

CDS

Download CDS FASTA

1752 bp · LXL04_033416|LXL04_033416|OH1004|CDS

ATGGCTCAAGAACCCTCTTCTTCTTCCCAAACCCTAGAATCTTCAATCAGCCATGAAGATCTTCAGCAACCAGCTTCTTCTGTTACTTCAAGTTCTAGTGATACAAACAACCCAACTCTCACGCGTAACGTATCCTCCAGTCGCCTCAACGCTAAGGCTCCGGAATTTGTTCCTCGAACTAGTACCGCCGCATCCTCGCCGTCTTCAGCCTCTACTACGACTGCCACTACTGTCACTAGTCGCCCCGATCTATCTCAGCC...

Protein

Download Protein FASTA

583 aa · LXL04_033416|LXL04_033416|OH1004|PROTEIN

MAQEPSSSSQTLESSISHEDLQQPASSVTSSSSDTNNPTLTRNVSSSRLNAKAPEFVPRTSTAASSPSSASTTTATTVTSRPDLSQPRLVISPPPTSPGIIHVYPSPNSPFHAPIPTHVPVSVPVQNHHAHHHHHHVPLQYHHHQHHNHNHNHPRPFNGATGFLDHKDVSVQAQRTVHGDPDSKDGLTDEATQKIINQAGLCSFLYMLICDSWLIDALLIKECVSVCLLVLLSPSISKVNLNTETKSALYNIVQFRQLSR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_033416`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_033416

Location Chr07:43328642-43331292 (-)

Description Similar to LARP6B: La-related protein 6B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g43970`	Transcriptional regulator.	No verified direct reference in this release
`At3g19090`	Transcriptional regulator.	No verified direct reference in this release
`At5g46250`	Transcriptional regulator.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033416 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0000494 box C/D sno(s)RNA 3'-end processing Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006396 RNA processing Biological Process

GO:0006397 mRNA processing Biological Process

GO:0007283 spermatogenesis Biological Process

GO:0008380 RNA splicing Biological Process

GO:0009846 pollen germination Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:0030154 cell differentiation Biological Process

GO:0032897 negative regulation of viral transcription Biological Process

GO:0036093 germ cell proliferation Biological Process

KEGG gene cross-reference

ath:AT2G43970

ath:AT3G19090

ath:AT5G46250

dre:334956

rno:686883

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.549

Rank 1 · LXL04_033416 · OH-1004

Nucleus0.427

Rank 2 · LXL04_033416 · OH-1004

Cell membrane0.071

Rank 3 · LXL04_033416 · OH-1004

Endoplasmic reticulum0.058

Rank 4 · LXL04_033416 · OH-1004

Mitochondrion0.049

Rank 5 · LXL04_033416 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05383.24La261-317 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_033416	`PF05383.24`	La	261	317	1.5e-17	64.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O80567`	Arabidopsis thaliana	La-related protein 6B	61.538%	Swiss-Prot	weak database homology
`Q9LHL3`	Arabidopsis thaliana	La-related protein 6C	42.679%	Swiss-Prot	moderate database homology
`Q94A38`	Arabidopsis thaliana	La-related protein 6A	37.463%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card