LXL04_033363 | RubberDandelionOmics

Gene overview

LXL04_033363

Reference: OH-1004 Chr: Chr07 Coordinates: 41690066-41692407 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1158 bp · LXL04_033363|LXL04_033363|OH1004|cDNA

ATGGAAACAATGGATGGACCCGTTCCAGAAGTTCGAACCGAAACCGAACCCCCTGTTGCGGAGGAATTAGGGAAAAATGTTGATGAAATCATCGTGAAGGTTGATGAGCTTGAGCAAAAACTGAACGAAGTTGAGCAATTCTACTCAAAACCACCCAAAAAACAATCAAACACTTCAAAAGCCAGTTCAGTCATGAAAGAGAAAGACAAAGATAAACAAATAACCAGCTTCAAAAGGCGCCAGCTGGACGCATCAAGAAG...

CDS

Download CDS FASTA

1158 bp · LXL04_033363|LXL04_033363|OH1004|CDS

ATGGAAACAATGGATGGACCCGTTCCAGAAGTTCGAACCGAAACCGAACCCCCTGTTGCGGAGGAATTAGGGAAAAATGTTGATGAAATCATCGTGAAGGTTGATGAGCTTGAGCAAAAACTGAACGAAGTTGAGCAATTCTACTCAAAACCACCCAAAAAACAATCAAACACTTCAAAAGCCAGTTCAGTCATGAAAGAGAAAGACAAAGATAAACAAATAACCAGCTTCAAAAGGCGCCAGCTGGACGCATCAAGAAG...

Protein

Download Protein FASTA

385 aa · LXL04_033363|LXL04_033363|OH1004|PROTEIN

METMDGPVPEVRTETEPPVAEELGKNVDEIIVKVDELEQKLNEVEQFYSKPPKKQSNTSKASSVMKEKDKDKQITSFKRRQLDASRREAAAAKRMQDLMKQFSGLLRQHIIYPFFQFHISTWATPFMQPVDVVGLGLHDYYEVIERPMDFSTVKTKMEAKDGTGYNNVREICADVRLIFKNAMKYNDERNDVHVMAKTLLAKFEEKWLQLLPKVDEEDERRKKEEAEAQLDVQLAQEVSHAKMARDLSAELDKVDKNLKD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_033363`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_033363

Location Chr07:41690066-41692407 (-)

Description Similar to GTE1: Transcription factor GTE1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g34900`	Transcription activator that plays a role in the promotion of seed germination by both negatively and positively regulating the abscisic acid (ABA) and phytochrome A (phyA) transduction pathways, respectively.	IMB1, a bromodomain protein induced during seed imbibition, regulates ABA- and phyA-mediated responses of germination in Arabidopsis.2003 · DOI: 10.1046/j.1365-313x.2003.01848.x
`At3g52280`	Regulates differences in leaf patterning between juvenile and mature leaves by controlling differences in the development of primordia produced during juvenile and mature phases.	The bromodomain protein GTE6 controls leaf development in Arabidopsis by histone acetylation at ASYMMETRIC LEAVES1.2005 · DOI: 10.1101/gad.352005
`At1g06230`	Involved in the activation and maintenance of cell division in the meristems and by this controls cell numbers in differentiated organs.	The Arabidopsis BET bromodomain factor GTE4 is involved in maintenance of the mitotic cell cycle during plant development.2010 · DOI: 10.1104/pp.109.150631 The Arabidopsis BET bromodomain factor GTE4 regulates the mitotic cell cycle.2010 · DOI: 10.4161/psb.5.6.11571
`At5g14270`	Transcription factor GTE9.	No verified direct reference in this release
`At1g73150`	Probable transcription factor that binds to acetylated histone H3.	The PHD domain of plant PIAS proteins mediates sumoylation of bromodomain GTE proteins.2008 · DOI: 10.1074/jbc.m708176200

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033363 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0009294 DNA-mediated transformation Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0010030 positive regulation of seed germination Biological Process

GO:0010629 negative regulation of gene expression Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0045931 positive regulation of mitotic cell cycle Biological Process

GO:0048364 root development Biological Process

GO:0000785 chromatin Cellular Component

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G06230

ath:AT1G73150

ath:AT2G34900

ath:AT3G52280

ath:AT5G14270

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.936

Rank 1 · LXL04_033363 · OH-1004

Cytoplasm0.162

Rank 2 · LXL04_033363 · OH-1004

Mitochondrion0.020

Rank 3 · LXL04_033363 · OH-1004

Cell membrane0.020

Rank 4 · LXL04_033363 · OH-1004

Endoplasmic reticulum0.009

Rank 5 · LXL04_033363 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00439.31Bromodomain123-197 aa

PF17035.11BET271-334 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_033363	`PF00439.31`	Bromodomain	123	197	1.4e-15	57.7
LXL04_033363	`PF17035.11`	BET	271	334	1.1e-17	64.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84XV2`	Arabidopsis thaliana	Transcription factor GTE1	49.167%	Swiss-Prot	moderate database homology
`Q9FT54`	Arabidopsis thaliana	Transcription factor GTE6	49.527%	Swiss-Prot	moderate database homology
`Q9LNC4`	Arabidopsis thaliana	Transcription factor GTE4	33.750%	Swiss-Prot	moderate database homology
`Q93YS6`	Arabidopsis thaliana	Transcription factor GTE9	32.377%	Swiss-Prot	moderate database homology
`Q9S7T1`	Arabidopsis thaliana	Transcription factor GTE3, chloroplastic	29.693%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card