LXL04_033294 | RubberDandelionOmics

Gene overview

LXL04_033294

Reference: OH-1004 Chr: Chr07 Coordinates: 40377237-40379591 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

633 bp · LXL04_033294|LXL04_033294|OH1004|cDNA

ATGTCCTTTCTGATTCTTTTAATTTTTAGTTGTTCTTGCTTGGACGTGACATTAAAAGCAGAGAATCCATTGCTATACCAACTCGATCCACTATCTTCAACACGTTTCATATTTGTTCTATCTATGGCAAGCTCATTGAGGTTGTATTTGACTTGCATACGAAACACTCTAGAGGCTGCCATGTGTTTGCAGAACTTCCCTTGTCAAGAAGTTGAAAGACATAACAAACCCGAAGTTGAAATGAAGACCAGTCCAGAACT...

CDS

Download CDS FASTA

633 bp · LXL04_033294|LXL04_033294|OH1004|CDS

ATGTCCTTTCTGATTCTTTTAATTTTTAGTTGTTCTTGCTTGGACGTGACATTAAAAGCAGAGAATCCATTGCTATACCAACTCGATCCACTATCTTCAACACGTTTCATATTTGTTCTATCTATGGCAAGCTCATTGAGGTTGTATTTGACTTGCATACGAAACACTCTAGAGGCTGCCATGTGTTTGCAGAACTTCCCTTGTCAAGAAGTTGAAAGACATAACAAACCCGAAGTTGAAATGAAGACCAGTCCAGAACT...

Protein

Download Protein FASTA

210 aa · LXL04_033294|LXL04_033294|OH1004|PROTEIN

MSFLILLIFSCSCLDVTLKAENPLLYQLDPLSSTRFIFVLSMASSLRLYLTCIRNTLEAAMCLQNFPCQEVERHNKPEVEMKTSPELLLNPVVICRNEAEKCLIETSINSLRISLKVKQADELENILTKKFLRFLSMRAEAFQVLRRKPVQGYDISFLITNYHCEEMQKHKLIDFIVQFMEDIDKEISELKMSMNTRGRLVATEFLKQFI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_033294`
TK1151 ID	TkA08G249120
OH-1004 ID	LXL04_033294
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_033294

Location Chr07:40377237-40379591 (+)

Description Similar to ARPC4: Actin-related protein 2/3 complex subunit 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g14147`	Functions as actin-binding component of the Arp2/3 complex which is involved in regulation of actin polymerization and together with an activating nucleation-promoting factor (NPF) mediates the formation of branched actin networks.	The association of the Arabidopsis actin-related protein2/3 complex with cell membranes is linked to its assembly status but not its activation.2009 · DOI: 10.1104/pp.109.143859

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033294 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000902 cell morphogenesis Biological Process

GO:0006887 exocytosis Biological Process

GO:0006909 phagocytosis Biological Process

GO:0007015 actin filament organization Biological Process

GO:0030041 actin filament polymerization Biological Process

GO:0034314 Arp2/3 complex-mediated actin nucleation Biological Process

GO:0045010 actin nucleation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005885 Arp2/3 protein complex Cellular Component

GO:0005938 cell cortex Cellular Component

KEGG gene cross-reference

ath:AT4G14147

ddi:DDB_G0269102

hsa:10093

mmu:68089

xla:108714705

xla:494639

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.527

Rank 1 · LXL04_033294 · OH-1004

Cytoplasm0.427

Rank 2 · LXL04_033294 · OH-1004

Endoplasmic reticulum0.070

Rank 3 · LXL04_033294 · OH-1004

Mitochondrion0.056

Rank 4 · LXL04_033294 · OH-1004

Golgi apparatus0.048

Rank 5 · LXL04_033294 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05856.18ARPC442-208 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_033294	`PF05856.18`	ARPC4	42	208	9.8e-81	270.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JUL9`	Arabidopsis thaliana	Actin-related protein 2/3 complex subunit 4	92.308%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card