LXL04_033251 | RubberDandelionOmics

Gene overview

LXL04_033251

Reference: OH-1004 Chr: Chr07 Coordinates: 39349800-39351487 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1005 bp · LXL04_033251|LXL04_033251|OH1004|cDNA

ATGGGAACCCCAAAAAGTAACCCGATTCAACAATCGTCTACTGTTAGTGCCTGCTCAGATTGGGATCTGGAATTTACTGACGAAGAACTTCAGTCAATTGAAGCCGCATTTGAATCTGccgcttcttcttcttcctcgtctTCCAAATCCGTTGCCGATTGCAACGGAGATCGTCGGAGAACTCGCCGCAGATTGCCTGATTCTTTGTTTAATTCCACAGAACGGTCTGCAGGGTTATTTAACAACTCTTCAAGTGAATG...

CDS

Download CDS FASTA

1005 bp · LXL04_033251|LXL04_033251|OH1004|CDS

ATGGGAACCCCAAAAAGTAACCCGATTCAACAATCGTCTACTGTTAGTGCCTGCTCAGATTGGGATCTGGAATTTACTGACGAAGAACTTCAGTCAATTGAAGCCGCATTTGAATCTGCCGCTTCTTCTTCTTCCTCGTCTTCCAAATCCGTTGCCGATTGCAACGGAGATCGTCGGAGAACTCGCCGCAGATTGCCTGATTCTTTGTTTAATTCCACAGAACGGTCTGCAGGGTTATTTAACAACTCTTCAAGTGAATG...

Protein

Download Protein FASTA

334 aa · LXL04_033251|LXL04_033251|OH1004|PROTEIN

MGTPKSNPIQQSSTVSACSDWDLEFTDEELQSIEAAFESAASSSSSSSKSVADCNGDRRRTRRRLPDSLFNSTERSAGLFNNSSSECNRIGASSSLSLLPCPRNRFSNPWNTSDRANSKMRYPAMTFKGHIVYSRTFPEVEKAADELLKFIALKKRDGICPVIGLDIEWRPSFRKGVKQGKAAVLQICADPATCHVMHIIHSGFPESLKSLLGDSKSVKVGVGIAGDARKVFNDHKVCVYGLEDLSFLANQKLGAVPKSW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_033251`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_033251

Location Chr07:39349800-39351487 (+)

Description Similar to WEX: Werner Syndrome-like exonuclease

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g13870`	Exonuclease that digests recessed strands of DNA duplexes in the 3' to 5' direction but hardly single-stranded DNA or blunt-ended duplexes.	Biochemical characterization of an exonuclease from Arabidopsis thaliana reveals similarities to the DNA exonuclease of the human Werner syndrome protein.2003 · DOI: 10.1074/jbc.m303891200

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033251 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000723 telomere maintenance Biological Process

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0000731 DNA synthesis involved in DNA repair Biological Process

GO:0006139 nucleobase-containing compound metabolic process Biological Process

GO:0006259 DNA metabolic process Biological Process

GO:0006260 DNA replication Biological Process

GO:0006284 base-excision repair Biological Process

GO:0006298 mismatch repair Biological Process

GO:0006302 double-strand break repair Biological Process

GO:0006974 DNA damage response Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0008340 determination of adult lifespan Biological Process

KEGG gene cross-reference

ath:AT4G13870

der:6551855

hsa:7486

mmu:22427

xla:398079

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.757

Rank 1 · LXL04_033251 · OH-1004

Cytoplasm0.239

Rank 2 · LXL04_033251 · OH-1004

Plastid0.052

Rank 3 · LXL04_033251 · OH-1004

Cell membrane0.050

Rank 4 · LXL04_033251 · OH-1004

Endoplasmic reticulum0.034

Rank 5 · LXL04_033251 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01612.27DNA_pol_A_exo1153-313 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_033251	`PF01612.27`	DNA_pol_A_exo1	153	313	4.9e-20	72.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84LH3`	Arabidopsis thaliana	3'-5' exonuclease	45.541%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card