LXL04_033182 | RubberDandelionOmics

Gene overview

LXL04_033182

Reference: OH-1004 Chr: Chr07 Coordinates: 37819304-37826041 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4908 bp · LXL04_033182|LXL04_033182|OH1004|cDNA

ATGGCGGAAAGCGAAACTGCAGATAGTAGTAAAAATGTAATCAAAGTTGAGGAAGAAATCGAAGGAGACCAAATTGGCACCAAAAACTACCGTTTCAGCAAAATCGGCGAATCTGTTCCCATCAAATCTGATGCCGATTTCAAATTCGATATGGACAACCTTCCGTCTCGTCCCATGGCAGTCTCAGAACGTTTTGGAGTGATTTTTGTTGCTCATTCGTCCGGGTTTTGTGTTGCAAGGACCAAAGATGTTATAAATAC...

CDS

Download CDS FASTA

4908 bp · LXL04_033182|LXL04_033182|OH1004|CDS

ATGGCGGAAAGCGAAACTGCAGATAGTAGTAAAAATGTAATCAAAGTTGAGGAAGAAATCGAAGGAGACCAAATTGGCACCAAAAACTACCGTTTCAGCAAAATCGGCGAATCTGTTCCCATCAAATCTGATGCCGATTTCAAATTCGATATGGACAACCTTCCGTCTCGTCCCATGGCAGTCTCAGAACGTTTTGGAGTGATTTTTGTTGCTCATTCGTCCGGGTTTTGTGTTGCAAGGACCAAAGATGTTATAAATAC...

Protein

Download Protein FASTA

1635 aa · LXL04_033182|LXL04_033182|OH1004|PROTEIN

MAESETADSSKNVIKVEEEIEGDQIGTKNYRFSKIGESVPIKSDADFKFDMDNLPSRPMAVSERFGVIFVAHSSGFCVARTKDVINTAEELKNEGNGSCIQELSLVDVSLGKVSILTLSSDSSLLAASVGFNLHFFSVDGLLNKDHEPLFSKALSESSSIKDMQWNPRLKDKYVVLTSDGKLYHAAGQDDLNNLMDNVDAVNWSVDGKFLAVAKYDYLSILSSKFEEKLRIKLLLDSLVDDSDADSAVKVDSVRWVRPDC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_033182`
TK1151 ID	TkA08G239690
OH-1004 ID	LXL04_033182
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	96.700
Protein coverage (%)	TK1151 98.757 / OH-1004 68.318 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_033182

Location Chr07:37819304-37826041 (-)

Description Similar to NUP214: Nuclear pore complex protein NUP214

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g55540`	Required for normal embryogenesis and seed viability.	LONO1 encoding a nucleoporin is required for embryogenesis and seed viability in Arabidopsis.2012 · DOI: 10.1104/pp.112.202192

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033182 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006405 RNA export from nucleus Biological Process

GO:0006406 mRNA export from nucleus Biological Process

GO:0006606 protein import into nucleus Biological Process

GO:0006611 protein export from nucleus Biological Process

GO:0006913 nucleocytoplasmic transport Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0010070 zygote asymmetric cell division Biological Process

GO:0015031 protein transport Biological Process

GO:0046822 regulation of nucleocytoplasmic transport Biological Process

GO:0051028 mRNA transport Biological Process

GO:0051726 regulation of cell cycle Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G55540

mmu:227720

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.846

Rank 1 · LXL04_033182 · OH-1004

Cytoplasm0.202

Rank 2 · LXL04_033182 · OH-1004

Cell membrane0.038

Rank 3 · LXL04_033182 · OH-1004

Endoplasmic reticulum0.034

Rank 4 · LXL04_033182 · OH-1004

Golgi apparatus0.021

Rank 5 · LXL04_033182 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF28654.1NUP214_coiled729-916 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_033182	`PF28654.1`	NUP214_coiled	729	916	8.3e-88	293.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4I1T7`	Arabidopsis thaliana	Nuclear pore complex protein NUP214	46.039%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card