LXL04_033146 | RubberDandelionOmics

Gene overview

LXL04_033146

Reference: OH-1004 Chr: Chr07 Coordinates: 37042173-37045051 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

957 bp · LXL04_033146|LXL04_033146|OH1004|cDNA

ATGGCGACCCTCGCCGGATTCGGGATCGGCTGTGGGACTCGAGTGGTTGTCCCGGAAATTTCCCCCCAATCAAAATGCATACTCCGTCCAATTCTATTACAAACCCGTGAAACTAGCAACACCTTTGTCAGTATCTGCTGTGTTCCAAAGCGAACTTTCTCAATCTCCGCGTCAGTTTCAGACGACAGCAGCAATAGCGTCAACGATCGACAAGTCCGCGTCCGTTTCGCCCCTTCTCCCACCGGTAATCTTCACGTCGG...

CDS

Download CDS FASTA

957 bp · LXL04_033146|LXL04_033146|OH1004|CDS

ATGGCGACCCTCGCCGGATTCGGGATCGGCTGTGGGACTCGAGTGGTTGTCCCGGAAATTTCCCCCCAATCAAAATGCATACTCCGTCCAATTCTATTACAAACCCGTGAAACTAGCAACACCTTTGTCAGTATCTGCTGTGTTCCAAAGCGAACTTTCTCAATCTCCGCGTCAGTTTCAGACGACAGCAGCAATAGCGTCAACGATCGACAAGTCCGCGTCCGTTTCGCCCCTTCTCCCACCGGTAATCTTCACGTCGG...

Protein

Download Protein FASTA

318 aa · LXL04_033146|LXL04_033146|OH1004|PROTEIN

MATLAGFGIGCGTRVVVPEISPQSKCILRPILLQTRETSNTFVSICCVPKRTFSISASVSDDSSNSVNDRQVRVRFAPSPTGNLHVGGARTALFNYLYARSKGGKFVLRIEDTDLERSTKESEEAMLRDLSWLGLTWDEGPGVDGDYGPYRQSESYEMYKQYAEKLLQSGQVYHCFCSNEMFKHLTCLELEDNKHVKPDFSITYLKGNETSLNDRSSRSHQIIRLTIESSHLEESGCVKSLCGGKNIGHTYRDSKLTRIL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_033146`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_033146

Location Chr07:37042173-37045051 (+)

Description Similar to Glutamate--tRNA ligase, chloroplastic/mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g64050`	Catalyzes the attachment of glutamate to tRNA(Glu) in a two-step reaction: glutamate is first activated by ATP to form Glu-AMP and then transferred to the acceptor end of tRNA(Glu).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033146 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006424 glutamyl-tRNA aminoacylation Biological Process

GO:0007005 mitochondrion organization Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0048481 plant ovule development Biological Process

GO:0048608 reproductive structure development Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

KEGG gene cross-reference

ath:AT5G64050

fno:Fnod_0678

fno:Fnod_0777

nta:107784556

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.867

Rank 1 · LXL04_033146 · OH-1004

Mitochondrion0.129

Rank 2 · LXL04_033146 · OH-1004

Nucleus0.049

Rank 3 · LXL04_033146 · OH-1004

Cytoplasm0.032

Rank 4 · LXL04_033146 · OH-1004

Cell membrane0.011

Rank 5 · LXL04_033146 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00749.28tRNA-synt_1c71-229 aa

PF00225.30Kinesin237-298 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_033146	`PF00749.28`	tRNA-synt_1c	71	229	3.2e-45	155.1
LXL04_033146	`PF00225.30`	Kinesin	237	298	5e-19	69.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FEA2`	Arabidopsis thaliana	Glutamate--tRNA ligase, chloroplastic/mitochondrial	65.031%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card