LXL04_033093 | RubberDandelionOmics

Gene overview

LXL04_033093

Reference: OH-1004 Chr: Chr07 Coordinates: 35766911-35768446 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1536 bp · LXL04_033093|LXL04_033093|OH1004|cDNA

ATGATGCGAATAAAGCCTCTGATTTCCACTCTTTCCTCGCAGCAACTCGCCCAAATCAAAGCTCATGTACTCAAATCTTCAGAACCATACGCACTGAACACTCTTCTCGATTCATTCGTAAACTCACACATCCCACAaaatacgttttctctctacAATCAAATGCTCCAAAGCTCAAATACCCACAACCATTTTAGCTTCAATTATGCTCTCAAAGCATGTTGTTTGACAGATTCGTTCAATAAAGGCCAAGAAATCCA...

CDS

Download CDS FASTA

1536 bp · LXL04_033093|LXL04_033093|OH1004|CDS

ATGATGCGAATAAAGCCTCTGATTTCCACTCTTTCCTCGCAGCAACTCGCCCAAATCAAAGCTCATGTACTCAAATCTTCAGAACCATACGCACTGAACACTCTTCTCGATTCATTCGTAAACTCACACATCCCACAAAATACGTTTTCTCTCTACAATCAAATGCTCCAAAGCTCAAATACCCACAACCATTTTAGCTTCAATTATGCTCTCAAAGCATGTTGTTTGACAGATTCGTTCAATAAAGGCCAAGAAATCCA...

Protein

Download Protein FASTA

511 aa · LXL04_033093|LXL04_033093|OH1004|PROTEIN

MMRIKPLISTLSSQQLAQIKAHVLKSSEPYALNTLLDSFVNSHIPQNTFSLYNQMLQSSNTHNHFSFNYALKACCLTDSFNKGQEIHAHVIKSGHFSHTYIQNSFIHFYVIQNDIIHAYRVFTTIDHPNVVSWTSIISGFSKCGLEKNAISMFSWMDVDPNANTLVSALSACSNIRELKLGKAVHCYGIRNSYQGNIILDNALLHFYMIVGSLENAQYLFAKMPKRDVVSWSTMVGGFVQTGLCEKAIDTFNEMVKGGEV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_033093`
TK1151 ID	TkA08G229790
OH-1004 ID	LXL04_033093
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	95.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_033093

Location Chr07:35766911-35768446 (+)

Description Similar to PCMP-H33: Pentatricopeptide repeat-containing protein At2g29760, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g29760`	Involved in RNA editing event in chloroplasts.	A study of new Arabidopsis chloroplast RNA editing mutants reveals general features of editing factors and their target sites.2009 · DOI: 10.1105/tpc.109.071472
`At4g38010`	Pentatricopeptide repeat-containing protein At4g38010.	No verified direct reference in this release
`At1g08070`	Involved in multiple sites RNA editing events in chloroplasts.	No verified direct reference in this release
`At3g05240`	Putative pentatricopeptide repeat-containing protein At3g05240.	No verified direct reference in this release
`At2g13600`	Pentatricopeptide repeat-containing protein At2g13600.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033093 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0009451 RNA modification Biological Process

GO:0031425 chloroplast RNA processing Biological Process

GO:0080156 mitochondrial mRNA modification Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0003729 mRNA binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G08070

ath:AT2G29760

ath:AT3G05240

ath:AT4G38010

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.710

Rank 1 · LXL04_033093 · OH-1004

Plastid0.120

Rank 2 · LXL04_033093 · OH-1004

Nucleus0.049

Rank 3 · LXL04_033093 · OH-1004

Cytoplasm0.031

Rank 4 · LXL04_033093 · OH-1004

Cell membrane0.005

Rank 5 · LXL04_033093 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13041.13PPR_232-75 aa

PF13041.13PPR_2128-173 aa

PF13041.13PPR_2226-275 aa

PF01535.27PPR229-258 aa

PF29070.1MSC6_N246-424 aa

PF13041.13PPR_2329-377 aa

PF20431.5E_motif468-508 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_033093	`PF13041.13`	PPR_2	32	75	6.5e-41	138.9
LXL04_033093	`PF13041.13`	PPR_2	128	173	6.5e-41	138.9
LXL04_033093	`PF13041.13`	PPR_2	226	275	6.5e-41	138.9
LXL04_033093	`PF01535.27`	PPR	229	258	6.2e-33	111.4
LXL04_033093	`PF29070.1`	MSC6_N	246	424	2.5e-11	44.0
LXL04_033093	`PF13041.13`	PPR_2	329	377	6.5e-41	138.9
LXL04_033093	`PF20431.5`	E_motif	468	508	2.5e-08	34.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O82380`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At2g29760, chloroplastic	33.210%	Swiss-Prot	moderate database homology
`Q9SZK1`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At4g38010	33.608%	Swiss-Prot	moderate database homology
`Q9LN01`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At1g08070, chloroplastic	32.054%	Swiss-Prot	moderate database homology
`Q9MA95`	Arabidopsis thaliana	Putative pentatricopeptide repeat-containing protein At3g05240	33.943%	Swiss-Prot	moderate database homology
`Q9SIT7`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At2g13600	32.046%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card