LXL04_032871 | RubberDandelionOmics

Gene overview

LXL04_032871

Reference: OH-1004 Chr: Chr07 Coordinates: 30762864-30763845 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

666 bp · LXL04_032871|LXL04_032871|OH1004|cDNA

ATGAAAAGATCGAAAACACAAACTCATGATTTCATAAATAACGAACCTTTCTCTCCACTGCCACCCAAAGAGAATTCAATTAGGCTCTTCGGTAAAGAATTCGGTGGCGGCGATCTGGCTACCCTTATCACCGAGGAGTCTAGTTCACCGGAAACCACCGCATTTATCCACAACGAAACAAAGGAAAACCCAGAAAGGAAATTTGAGTGCAATTATTGTTGCAGAAACTTCCCTACATCTCAAGCCCTTGGAGGCCATCA...

CDS

Download CDS FASTA

666 bp · LXL04_032871|LXL04_032871|OH1004|CDS

ATGAAAAGATCGAAAACACAAACTCATGATTTCATAAATAACGAACCTTTCTCTCCACTGCCACCCAAAGAGAATTCAATTAGGCTCTTCGGTAAAGAATTCGGTGGCGGCGATCTGGCTACCCTTATCACCGAGGAGTCTAGTTCACCGGAAACCACCGCATTTATCCACAACGAAACAAAGGAAAACCCAGAAAGGAAATTTGAGTGCAATTATTGTTGCAGAAACTTCCCTACATCTCAAGCCCTTGGAGGCCATCA...

Protein

Download Protein FASTA

221 aa · LXL04_032871|LXL04_032871|OH1004|PROTEIN

MKRSKTQTHDFINNEPFSPLPPKENSIRLFGKEFGGGDLATLITEESSSPETTAFIHNETKENPERKFECNYCCRNFPTSQALGGHQNAHRRERLKAKRPHIQPNFSTAHHHEYYDLTTTTPPPPCPINQSNNIRFINGGKASYISHHQTPINGRPLALWRFPIVVHKSTAFNNGGLLNSSETGSRSRNVYMHELKPNIRDQVIRAYMQTEYAEAYEVSTT

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032871`
TK1151 ID	TkA08G210310
OH-1004 ID	LXL04_032871
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032871

Location Chr07:30762864-30763845 (-)

Description Similar to ZFP8: Zinc finger protein 8

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g41940`	Probable transcription factor required for the initiation of inflorescence trichomes in response to gibberellin and cytokinin.	Integration of cytokinin and gibberellin signalling by Arabidopsis transcription factors GIS, ZFP8 and GIS2 in the regulation of epidermal cell fate.2007 · DOI: 10.1242/dev.005017
`At3g58070`	Probable transcription factor required for the initiation of inflorescence trichomes in response to gibberellin (GA).	No verified direct reference in this release
`At5g06650`	Probable transcription factor required for the initiation of inflorescence trichomes in response to gibberellin and cytokinin.	Integration of cytokinin and gibberellin signalling by Arabidopsis transcription factors GIS, ZFP8 and GIS2 in the regulation of epidermal cell fate.2007 · DOI: 10.1242/dev.005017
`At5g25160`	Acts as a negative regulator of abscisic acid (ABA) signaling during germination and early seedling development.	The Arabidopsis ZINC FINGER PROTEIN3 Interferes with Abscisic Acid and Light Signaling in Seed Germination and Plant Development.2014 · DOI: 10.1104/pp.113.234294
`At1g68360`	Probable transcription factor required for the initiation of inflorescence trichomes in response to gibberellin and cytokinin.	GLABROUS INFLORESCENCE STEMS3 (GIS3) regulates trichome initiation and development in Arabidopsis.2015 · DOI: 10.1111/nph.13218

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032871 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009735 response to cytokinin Biological Process

GO:0009736 cytokinin-activated signaling pathway Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009739 response to gibberellin Biological Process

GO:0009740 gibberellic acid mediated signaling pathway Biological Process

GO:0009788 negative regulation of abscisic acid-activated signaling pathway Biological Process

GO:0010026 trichome differentiation Biological Process

GO:0010090 trichome morphogenesis Biological Process

GO:0010091 trichome branching Biological Process

GO:0019760 glucosinolate metabolic process Biological Process

KEGG gene cross-reference

ath:AT1G68360

ath:AT2G41940

ath:AT3G58070

ath:AT5G06650

ath:AT5G25160

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.910

Rank 1 · LXL04_032871 · OH-1004

Cytoplasm0.145

Rank 2 · LXL04_032871 · OH-1004

Cell membrane0.042

Rank 3 · LXL04_032871 · OH-1004

Endoplasmic reticulum0.030

Rank 4 · LXL04_032871 · OH-1004

Plastid0.013

Rank 5 · LXL04_032871 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13912.13zf-C2H2_668-93 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032871	`PF13912.13`	zf-C2H2_6	68	93	4.8e-06	27.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P93751`	Arabidopsis thaliana	Zinc finger protein 8	34.082%	Swiss-Prot	moderate database homology
`Q84WI0`	Arabidopsis thaliana	Zinc finger protein GIS	34.538%	Swiss-Prot	moderate database homology
`Q9FG05`	Arabidopsis thaliana	Zinc finger protein GIS2	47.321%	Swiss-Prot	weak database homology
`Q39262`	Arabidopsis thaliana	Zinc finger protein 3	40.952%	Swiss-Prot	weak database homology
`Q9C9H1`	Arabidopsis thaliana	Zinc finger protein GIS3	47.143%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card