LXL04_032755 | RubberDandelionOmics

Gene overview

LXL04_032755

Reference: OH-1004 Chr: Chr07 Coordinates: 29007919-29010115 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1265 bp · LXL04_032755|LXL04_032755|OH1004|cDNA

ATGTATTCTTTGATCACTTTCTCTAggttgtggTTAGGCCTTTTTCAATAAACGATACGAAATTACAATTGCAGGCTTTGATGTCAAGGTAGTGAGTCATTCTTTGTATGAATATGATGATGCGCCCAATGAATCCACCTCCACCTGCACCTGCACCGTGGGTCCCACCATTGCCCCCAATGACAAGTGGCTTTTGGAACGCTACAAATGTTCAAAGTTCCTTAAAGGAATTACAGAACACCATCGATCTTGCAGAAGCT...

CDS

Download CDS FASTA

1158 bp · LXL04_032755|LXL04_032755|OH1004|CDS

ATGAATATGATGATGCGCCCAATGAATCCACCTCCACCTGCACCTGCACCGTGGGTCCCACCATTGCCCCCAATGACAAGTGGCTTTTGGAACGCTACAAATGTTCAAAGTTCCTTAAAGGAATTACAGAACACCATCGATCTTGCAGAAGCTATGGAGAAGGAACTGGAGATGCTTATGGCTATGAAAGATGGCAAGAATCACATAGAAGAAACAGAGGAAAAGCCAAATGAAACTTCCATGGAAAAGTTTTCTAATTT...

Protein

Download Protein FASTA

385 aa · LXL04_032755|LXL04_032755|OH1004|PROTEIN

MNMMMRPMNPPPPAPAPWVPPLPPMTSGFWNATNVQSSLKELQNTIDLAEAMEKELEMLMAMKDGKNHIEETEEKPNETSMEKFSNFIKNNKISIETQEKISLEAANSLIAKLKNDLQPFKVITGDKTPWEEKSAAVKLANKLKKHKINKLWRKRKRQHIGEMLSKEREQFDQADREADEWRAREIANEVAKQRVEKMKEIAKQKAKEERKRLESELELVLIVEKLQELRSIRIQKLTKQGHFLPEEDNKFLERIRVAVE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032755`
TK1151 ID	TkA08G203250
OH-1004 ID	LXL04_032755
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	98.400
Protein coverage (%)	TK1151 99.740 / OH-1004 99.740 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032755

Location Chr07:29007919-29010115 (+)

Description Similar to SNRNP59: U11/U12 small nuclear ribonucleoprotein 59 kDa protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g46200`	U11/U12 small nuclear ribonucleoprotein 59 kDa protein.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032755 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0008380 RNA splicing Biological Process

GO:0051384 response to glucocorticoid Biological Process

GO:0005681 spliceosomal complex Cellular Component

GO:0005689 U12-type spliceosomal complex Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0034693 U11/U12 snRNP Cellular Component

GO:0071016 U12-type precatalytic spliceosome Cellular Component

GO:0089701 U2AF complex Cellular Component

KEGG gene cross-reference

ath:AT2G46200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.894

Rank 1 · LXL04_032755 · OH-1004

Cytoplasm0.172

Rank 2 · LXL04_032755 · OH-1004

Cell membrane0.038

Rank 3 · LXL04_032755 · OH-1004

Mitochondrion0.017

Rank 4 · LXL04_032755 · OH-1004

Endoplasmic reticulum0.014

Rank 5 · LXL04_032755 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16021.11PDCD7133-381 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032755	`PF16021.11`	PDCD7	133	381	3.9e-22	79.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VYD3`	Arabidopsis thaliana	U11/U12 small nuclear ribonucleoprotein 59 kDa protein	49.871%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card