LXL04_032717 | RubberDandelionOmics

Gene overview

LXL04_032717

Reference: OH-1004 Chr: Chr07 Coordinates: 28270273-28272084 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1020 bp · LXL04_032717|LXL04_032717|OH1004|cDNA

ATGGTACAACTCGTTTATATGTTGGTCGTTTGTCTTCAAGAACACGCTCTCGCGATCTGGAGTACCTTTTCAGCAAATACGGGAGGTTATCCTGACCTGGACTGGTGgtcaatggtggaaatggtgGGAAGTCTTGCCAGAGTGTGTAGTAGGAGACTTTTGGCGATTACTTTGTGTAGTGTTAATACCACCTGTACCTGTGTTTTATGGAATCCAAATCCAATTCCAAAAATGGTGTTTAAAGTACGCGATGTGGATAT...

CDS

Download CDS FASTA

1020 bp · LXL04_032717|LXL04_032717|OH1004|CDS

ATGGTACAACTCGTTTATATGTTGGTCGTTTGTCTTCAAGAACACGCTCTCGCGATCTGGAGTACCTTTTCAGCAAATACGGGAGGTTATCCTGACCTGGACTGGTGGTCAATGGTGGAAATGGTGGGAAGTCTTGCCAGAGTGTGTAGTAGGAGACTTTTGGCGATTACTTTGTGTAGTGTTAATACCACCTGTACCTGTGTTTTATGGAATCCAAATCCAATTCCAAAAATGGTGTTTAAAGTACGCGATGTGGATAT...

Protein

Download Protein FASTA

339 aa · LXL04_032717|LXL04_032717|OH1004|PROTEIN

MVQLVYMLVVCLQEHALAIWSTFSANTGGYPDLDWWSMVEMVGSLARVCSRRLLAITLCSVNTTCTCVLWNPNPIPKMVFKVRDVDMKHDFAFVEFSDPRDADDARYSLNGRDLNGSRLLVEFAKGTPRGPGGSREYVGRGPPPGSGRCFNCGLDGHWARDCKAGDWKNKCYRCGERGHIERNCQNSPKKLKRGRSYSRSPVRSRSPTRRRRNRSPSYSRSPSYSRSRSPVRKEVERRSRSRSRSPEGRGSKGRKRTQSP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032717`
TK1151 ID	TkA08G200380
OH-1004 ID	LXL04_032717
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	89.600
Protein coverage (%)	TK1151 70.107 / OH-1004 59.292 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032717

Location Chr07:28270273-28272084 (-)

Description Similar to RS2Z32: Serine/arginine-rich splicing factor RS2Z32

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g53500`	Probably involved in intron recognition and spliceosome assembly.	No verified direct reference in this release
`At2g37340`	Splicing factor involved in constitutive and/or alternative splicing.	Evolutionary conservation and regulation of particular alternative splicing events in plant SR proteins.2006 · DOI: 10.1093/nar/gkl570 CYCLIN-DEPENDENT KINASE G1 is associated with the spliceosome to regulate CALLOSE SYNTHASE5 splicing and pollen wall formation in Arabidopsis.2013 · DOI: 10.1105/tpc.112.107896

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032717 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000245 spliceosomal complex assembly Biological Process

GO:0000375 RNA splicing, via transesterification reactions Biological Process

GO:0000381 regulation of alternative mRNA splicing, via spliceosome Biological Process

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0006397 mRNA processing Biological Process

GO:0008380 RNA splicing Biological Process

GO:0032868 response to insulin Biological Process

GO:0048025 negative regulation of mRNA splicing, via spliceosome Biological Process

GO:0051028 mRNA transport Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005681 spliceosomal complex Cellular Component

KEGG gene cross-reference

ath:AT2G37340

ath:AT3G53500

bta:507066

hsa:6429

hsa:6432

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.906

Rank 1 · LXL04_032717 · OH-1004

Cytoplasm0.234

Rank 2 · LXL04_032717 · OH-1004

Cell membrane0.025

Rank 3 · LXL04_032717 · OH-1004

Mitochondrion0.017

Rank 4 · LXL04_032717 · OH-1004

Endoplasmic reticulum0.016

Rank 5 · LXL04_032717 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00076.29RRM_185-119 aa

PF00098.29zf-CCHC148-163 aa

PF00098.29zf-CCHC169-185 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032717	`PF00076.29`	RRM_1	85	119	1.8e-06	28.4
LXL04_032717	`PF00098.29`	zf-CCHC	148	163	9.4e-11	42.0
LXL04_032717	`PF00098.29`	zf-CCHC	169	185	9.4e-11	42.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FYB7`	Arabidopsis thaliana	Serine/arginine-rich splicing factor RS2Z32	56.420%	Swiss-Prot	strong database homology
`Q8VYA5`	Arabidopsis thaliana	Serine/arginine-rich splicing factor RS2Z33	76.991%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card