LXL04_032683 | RubberDandelionOmics

Gene overview

LXL04_032683

Reference: OH-1004 Chr: Chr07 Coordinates: 27777740-27780898 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2397 bp · LXL04_032683|LXL04_032683|OH1004|cDNA

ATGGAACCAGAGAGGTCTGATACAAGACGTGGACATGATGACATGGAAGATAACAGCAACGATAAATCACGAGAATCAAAGCACCGTAGTAAGGAGAAAAGTAGGAGTAGTCGAAGAGAAGAGAATAAGGATCATAGAAGCAGAGACCGAGAAAAGTCAAAGATCGGTGATGCTTCAAAGGAAAGAGACAAAGAGTCTGTGAAAGATCTGAACAGAGACCGAAGAAAAGAAGATGGAGAAGACCGTGAAAAAGACAGAAC...

CDS

Download CDS FASTA

2397 bp · LXL04_032683|LXL04_032683|OH1004|CDS

ATGGAACCAGAGAGGTCTGATACAAGACGTGGACATGATGACATGGAAGATAACAGCAACGATAAATCACGAGAATCAAAGCACCGTAGTAAGGAGAAAAGTAGGAGTAGTCGAAGAGAAGAGAATAAGGATCATAGAAGCAGAGACCGAGAAAAGTCAAAGATCGGTGATGCTTCAAAGGAAAGAGACAAAGAGTCTGTGAAAGATCTGAACAGAGACCGAAGAAAAGAAGATGGAGAAGACCGTGAAAAAGACAGAAC...

Protein

Download Protein FASTA

798 aa · LXL04_032683|LXL04_032683|OH1004|PROTEIN

MEPERSDTRRGHDDMEDNSNDKSRESKHRSKEKSRSSRREENKDHRSRDREKSKIGDASKERDKESVKDLNRDRRKEDGEDREKDRTRDKVREKENDREKDKEKHRDRDRDRDRDRGNEKGKERTREKDREKNKERDDSKSLKNEASVEDEHGGSHSQQSATEIQDRIMRMKEERLKKKSEGGSGSDILSWVGKSRKLEEKKLSEKEKALQRSKMFEEQDNVTQGEDEYEPPARKHTSRDLAGFKVLDGLDKVIEGGAVV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032683`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032683

Location Chr07:27777740-27780898 (-)

Description Similar to DOT2: SART-1 family protein DOT2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g16780`	Plays a role in root, shoot and flower development.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032683 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000244 spliceosomal tri-snRNP complex assembly Biological Process

GO:0000387 spliceosomal snRNP assembly Biological Process

GO:0000388 spliceosome conformational change to release U4 (or U4atac) and U1 (or U11) Biological Process

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0000481 maturation of 5S rRNA Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0007064 mitotic sister chromatid cohesion Biological Process

GO:0009908 flower development Biological Process

GO:0009933 meristem structural organization Biological Process

GO:0010087 phloem or xylem histogenesis Biological Process

GO:0010305 leaf vascular tissue pattern formation Biological Process

GO:0010468 regulation of gene expression Biological Process

KEGG gene cross-reference

ath:AT5G16780

dre:794108

hsa:9092

mmu:20227

rno:29678

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.968

Rank 1 · LXL04_032683 · OH-1004

Cytoplasm0.126

Rank 2 · LXL04_032683 · OH-1004

Cell membrane0.016

Rank 3 · LXL04_032683 · OH-1004

Mitochondrion0.013

Rank 4 · LXL04_032683 · OH-1004

Endoplasmic reticulum0.007

Rank 5 · LXL04_032683 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03343.19SART-1173-649 aa

PF03343.19SART-1661-707 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032683	`PF03343.19`	SART-1	173	649	1.7e-68	232.5
LXL04_032683	`PF03343.19`	SART-1	661	707	1.7e-68	232.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LFE0`	Arabidopsis thaliana	SART-1 family protein DOT2	58.229%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card