LXL04_032583 | RubberDandelionOmics

Gene overview

LXL04_032583

Reference: OH-1004 Chr: Chr07 Coordinates: 25824923-25826884 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1533 bp · LXL04_032583|LXL04_032583|OH1004|cDNA

ATGGCCTCTTCAGACGACGACTTCCCTTTGATCGGCGACACCACCACCACTAACCACCAAACAAATCCTGATTTCCACCACCAGCTCTCCGGAAATGCCCACTTTTTAGCCTCACAGACGACTCCGATTAACGCACCACCACCTCCAAGGCCGGGACAGGAAGCCAATGGAGAGGGTTACAGCGACGGCGCGTTCTGTTCACAACCTATGGTTGTCGCTCCGTACGAAAACGAGTCCGATCCGAACAGATCTAGGATTAA...

CDS

Download CDS FASTA

1533 bp · LXL04_032583|LXL04_032583|OH1004|CDS

ATGGCCTCTTCAGACGACGACTTCCCTTTGATCGGCGACACCACCACCACTAACCACCAAACAAATCCTGATTTCCACCACCAGCTCTCCGGAAATGCCCACTTTTTAGCCTCACAGACGACTCCGATTAACGCACCACCACCTCCAAGGCCGGGACAGGAAGCCAATGGAGAGGGTTACAGCGACGGCGCGTTCTGTTCACAACCTATGGTTGTCGCTCCGTACGAAAACGAGTCCGATCCGAACAGATCTAGGATTAA...

Protein

Download Protein FASTA

510 aa · LXL04_032583|LXL04_032583|OH1004|PROTEIN

MASSDDDFPLIGDTTTTNHQTNPDFHHQLSGNAHFLASQTTPINAPPPPRPGQEANGEGYSDGAFCSQPMVVAPYENESDPNRSRINGARSEKWSDREELSDGGTPYHYSKKAKIAGSSSGGEYRKDREEWSDTAIACLLDAYLDKFMQLNRGNLRGRDWEEVATIVSERCEKQTKSVEQCKNKVDNLKKRYKLERHRMMNTNAGNATSHWPWFKKMEQIVGNSLPLKTVLSEDNSAGGMSSPVRQSKRYGTATSSPSCQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032583`
TK1151 ID	TkA08G189500
OH-1004 ID	LXL04_032583
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.200
Protein coverage (%)	TK1151 90.647 / OH-1004 24.706 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032583

Location Chr07:25824923-25826884 (-)

Description Similar to pyrH: Uridylate kinase (Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g18680`	Catalyzes the reversible phosphorylation of UMP to UDP.	A protein related to prokaryotic UMP kinases is involved in psaA/B transcript accumulation in Arabidopsis.2009 · DOI: 10.1007/s11103-008-9433-2 PUMPKIN, the Sole Plastid UMP Kinase, Associates with Group II Introns and Alters Their Metabolism.2019 · DOI: 10.1104/pp.18.00687

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032583 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006225 UDP biosynthetic process Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0031425 chloroplast RNA processing Biological Process

GO:0042548 regulation of photosynthesis, light reaction Biological Process

GO:0044210 'de novo' CTP biosynthetic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0033862 UMP kinase activity Molecular Function

KEGG gene cross-reference

ana:alr1207

ath:AT3G18680

ava:Ava_0628

gka:GK1251

pma:Pro_0522

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.926

Rank 1 · LXL04_032583 · OH-1004

Cytoplasm0.097

Rank 2 · LXL04_032583 · OH-1004

Cell membrane0.042

Rank 3 · LXL04_032583 · OH-1004

Plastid0.028

Rank 4 · LXL04_032583 · OH-1004

Endoplasmic reticulum0.023

Rank 5 · LXL04_032583 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13837.13Myb_DNA-bind_4128-220 aa

PF10545.16MADF_DNA_bdg153-218 aa

PF00696.34AA_kinase276-483 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032583	`PF13837.13`	Myb_DNA-bind_4	128	220	5.3e-16	59.5
LXL04_032583	`PF10545.16`	MADF_DNA_bdg	153	218	1.5e-06	29.1
LXL04_032583	`PF00696.34`	AA_kinase	276	483	1.4e-25	91.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LSA9`	Arabidopsis thaliana	Uridylate kinase PUMPKIN, chloroplastic	55.649%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card