RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_032480
Reference: OH-1004 Chr: Chr07 Coordinates: 23927311-23928531 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

804 bp · LXL04_032480|LXL04_032480|OH1004|cDNA

ATGGACGGACCCCTAATCAACGAAGACCGGTGGCTTGTACCCGAGGCATACTCCACCGTGCTCATGGCTCCGCTAGCTGGGCTCAAGGTACTTCTTCGATTCTCTTTGATTACTCCTCCAGTTCTCCAATTCAGTTTCATTATCCTTGATCCCCTCTTGTTACTGTCGAATGATGCTTTTTCTCTGGCGTCAGGCGACACAAAGGTGATTGCAGCTGTTTACGGACCGAAAGCTGGAACTAGGAAAAATGAAAACCCCGA...

CDS

Download CDS FASTA

804 bp · LXL04_032480|LXL04_032480|OH1004|CDS

ATGGACGGACCCCTAATCAACGAAGACCGGTGGCTTGTACCCGAGGCATACTCCACCGTGCTCATGGCTCCGCTAGCTGGGCTCAAGGTACTTCTTCGATTCTCTTTGATTACTCCTCCAGTTCTCCAATTCAGTTTCATTATCCTTGATCCCCTCTTGTTACTGTCGAATGATGCTTTTTCTCTGGCGTCAGGCGACACAAAGGTGATTGCAGCTGTTTACGGACCGAAAGCTGGAACTAGGAAAAATGAAAACCCCGA...

Protein

Download Protein FASTA

267 aa · LXL04_032480|LXL04_032480|OH1004|PROTEIN

MDGPLINEDRWLVPEAYSTVLMAPLAGLKVLLRFSLITPPVLQFSFIILDPLLLLSNDAFSLASGDTKVIAAVYGPKAGTRKNENPEKACIEVIWKPKTGQSGKSESEYEMVLKKTLQSICLLNVHPNTTTSIVIQVVNDDGALLPCAINAACAALVDAGTPLKHLAVAICCCMAENGQILLDPSKMEEQKVKAFVYLAFPNSMVSVLPEGGKSMEHGILTSVTHGVMAVDDYFSCLKLGRPAASELSDFIRNSLKSKAG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_032480
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_032480
LocationChr07:23927311-23928531 (-)
DescriptionSimilar to RRP46: Exosome complex exonuclease RRP46 homolog
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g46210 Probable component of the exosome 3'->5' exoribonuclease complex, a complex that degrades inherently unstable mRNAs containing AU-rich elements (AREs) within their 3'-untranslated regions. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os03g0854200 May participate in RNA processing and degradation.
Structural and biochemical characterization of CRN-5 and Rrp46: an exosome component participating in apoptotic DNA degradation.2010 · DOI: 10.1261/rna.2180810
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_032480 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0000956 nuclear-transcribed mRNA catabolic process Biological Process
GO:0006364 rRNA processing Biological Process
GO:0006396 RNA processing Biological Process
GO:0006401 RNA catabolic process Biological Process
GO:0006402 mRNA catabolic process Biological Process
GO:0010467 gene expression Biological Process
GO:0016075 rRNA catabolic process Biological Process
GO:0034475 U4 snRNA 3'-end processing Biological Process
GO:0045006 DNA deamination Biological Process
GO:0051607 defense response to virus Biological Process
GO:0071028 nuclear mRNA surveillance Biological Process
GO:0071051 poly(A)-dependent snoRNA 3'-end processing Biological Process
KEGG gene cross-reference
ath:AT3G46210
dosa:Os03g0854200
hbu:Hbut_0571
hsa:56915
mmu:27998
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.533
Rank 1 · LXL04_032480 · OH-1004
Nucleus0.510
Rank 2 · LXL04_032480 · OH-1004
Mitochondrion0.082
Rank 3 · LXL04_032480 · OH-1004
Peroxisome0.068
Rank 4 · LXL04_032480 · OH-1004
Endoplasmic reticulum0.040
Rank 5 · LXL04_032480 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01138.28RNase_PH63-162 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_032480PF01138.28RNase_PH631622.8e-1970.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9LX74Arabidopsis thalianaExosome complex exonuclease RRP46 homolog68.750%Swiss-Protstrong database homology
Q84T68Oryza sativa subsp. japonicaExosome complex exonuclease RRP46 homolog61.765%Swiss-Protstrong database homology

JBrowse

View in Genome Browser