LXL04_032445 | RubberDandelionOmics

Gene overview

LXL04_032445

Reference: OH-1004 Chr: Chr07 Coordinates: 23131053-23132838 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1251 bp · LXL04_032445|LXL04_032445|OH1004|cDNA

ATGTCGGAGGTGTCGAGGAAGGTTTGGGTGCTCCATAGAAAGCGGACATCCCCATACAACCCAAACCCTGAGCTGATACCTCAAGACCTTGTGAACCCAGTTTTCACTGATAAAGACAAAGCCGCTGCTCACACGAAGGGAGGTGCAAAGAAGGTTGTGATCTCTGCTCCAAGTGCAAATGCTCCCATGTTTGTAATGGGTGTGAATGAGAAGGAATACAAGTCTGACATCACCATTGTCTCTAATGCCAGCTGTACCAC...

CDS

Download CDS FASTA

1251 bp · LXL04_032445|LXL04_032445|OH1004|CDS

ATGTCGGAGGTGTCGAGGAAGGTTTGGGTGCTCCATAGAAAGCGGACATCCCCATACAACCCAAACCCTGAGCTGATACCTCAAGACCTTGTGAACCCAGTTTTCACTGATAAAGACAAAGCCGCTGCTCACACGAAGGGAGGTGCAAAGAAGGTTGTGATCTCTGCTCCAAGTGCAAATGCTCCCATGTTTGTAATGGGTGTGAATGAGAAGGAATACAAGTCTGACATCACCATTGTCTCTAATGCCAGCTGTACCAC...

Protein

Download Protein FASTA

416 aa · LXL04_032445|LXL04_032445|OH1004|PROTEIN

MSEVSRKVWVLHRKRTSPYNPNPELIPQDLVNPVFTDKDKAAAHTKGGAKKVVISAPSANAPMFVMGVNEKEYKSDITIVSNASCTTNCLAPLAKVINDKFGIVEGLMITVHSITATQKTVDGPSMKDWRGGRAASFNIIPSSTGAAKKWSLYLAFGHPHCERSNARHVRSGHSRLGFLGQYVLEMAEAEFFLQRYPRESPGPMRERVYALIAKRYLPKWVKAASLHNLIFQYDDMDKLLRIEREPPVKSIVWALFGAIY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032445`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032445

Location Chr07:23131053-23132838 (-)

Description Similar to RNC1: Ribonuclease III domain-containing protein RNC1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g37510`	Binds specific group II introns in chloroplasts and facilitates their splicing.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0810100`	Binds specific group II introns in chloroplasts and facilitates their splicing.	No verified direct reference in this release
`Os02g0601300`	Key enzyme in glycolysis that catalyzes the first step of the pathway by converting D-glyceraldehyde 3-phosphate (G3P) into 3-phospho-D-glyceroyl phosphate.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032445 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000373 Group II intron splicing Biological Process

GO:0006006 glucose metabolic process Biological Process

GO:0006096 glycolytic process Biological Process

GO:0006396 RNA processing Biological Process

GO:0006397 mRNA processing Biological Process

GO:0008380 RNA splicing Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0042254 ribosome biogenesis Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

KEGG gene cross-reference

ath:AT4G37510

dosa:Os01g0810100

dosa:Os02g0601300

zma:100125654

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.444

Rank 1 · LXL04_032445 · OH-1004

Nucleus0.418

Rank 2 · LXL04_032445 · OH-1004

Mitochondrion0.117

Rank 3 · LXL04_032445 · OH-1004

Cell membrane0.065

Rank 4 · LXL04_032445 · OH-1004

Endoplasmic reticulum0.054

Rank 5 · LXL04_032445 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02800.27Gp_dh_C84-149 aa

PF14622.12Ribonucleas_3_3171-267 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032445	`PF02800.27`	Gp_dh_C	84	149	1.6e-27	97.1
LXL04_032445	`PF14622.12`	Ribonucleas_3_3	171	267	1.2e-06	29.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SZV0`	Arabidopsis thaliana	Ribonuclease III domain-containing protein RNC1, chloroplastic	72.031%	Swiss-Prot	moderate database homology
`Q8S1Z0`	Oryza sativa subsp. japonica	Ribonuclease III domain-containing protein RNC1, chloroplastic	68.821%	Swiss-Prot	moderate database homology
`Q6K5G8`	Oryza sativa subsp. japonica	Glyceraldehyde-3-phosphate dehydrogenase 3, cytosolic	82.222%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card