LXL04_032376 | RubberDandelionOmics

Gene overview

LXL04_032376

Reference: OH-1004 Chr: Chr07 Coordinates: 21505065-21507175 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1446 bp · LXL04_032376|LXL04_032376|OH1004|cDNA

ATGACAAGAGTTTTTTCACCCTATTTTGATCCCGAATTTGATTCTCTTTCAGAAAGGATCAACGGCCCACCTTGCAGAGTGACCTTTGACAACGATAGCTTAGCGGATTGTACCATCGTGAAGATAGATTGTGTAAATAAGCAAGCTCAACTCCTTGATGTGGTCCAGGTTCTAACGGAAGTCAACCTAACTATCTCAAAAGGCTATATATCTTCTGATGCCGGATGGTTCATGGATGTATTTCATGTTAAAGATGGTAA...

CDS

Download CDS FASTA

1446 bp · LXL04_032376|LXL04_032376|OH1004|CDS

ATGACAAGAGTTTTTTCACCCTATTTTGATCCCGAATTTGATTCTCTTTCAGAAAGGATCAACGGCCCACCTTGCAGAGTGACCTTTGACAACGATAGCTTAGCGGATTGTACCATCGTGAAGATAGATTGTGTAAATAAGCAAGCTCAACTCCTTGATGTGGTCCAGGTTCTAACGGAAGTCAACCTAACTATCTCAAAAGGCTATATATCTTCTGATGCCGGATGGTTCATGGATGTATTTCATGTTAAAGATGGTAA...

Protein

Download Protein FASTA

481 aa · LXL04_032376|LXL04_032376|OH1004|PROTEIN

MTRVFSPYFDPEFDSLSERINGPPCRVTFDNDSLADCTIVKIDCVNKQAQLLDVVQVLTEVNLTISKGYISSDAGWFMDVFHVKDGNGKKVTDQSVINYIQQTIGSNRGAASKLTTQKSKLLNTEPTAIEMTATDRPGLFSEISAALTDLHCNIVEAHAWSHNARLACVAYINDQSSDTRIDGHRLAAIEHHLNTILHASTTPENTYLQSSTQHKDVMSTGFIPGGSEGTMTTVERRLHQLLLSVHDFDVPPTRAAVSPT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032376`
TK1151 ID	TkA08G170180
OH-1004 ID	LXL04_032376
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032376

Location Chr07:21505065-21507175 (+)

Description Similar to ACR2: ACT domain-containing protein ACR2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g25320`	May bind amino acids.	No verified direct reference in this release
`At1g76990`	May bind amino acids.	Molecular characterization of a novel gene family encoding ACT domain repeat proteins in Arabidopsis.2002 · DOI: 10.1104/pp.007484
`At1g69040`	May bind amino acids.	No verified direct reference in this release
`At3g01990`	May bind amino acids.	No verified direct reference in this release
`At2g03730`	May bind amino acids.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032376 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006521 regulation of amino acid metabolic process Biological Process

GO:0009735 response to cytokinin Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016597 amino acid binding Molecular Function

KEGG gene cross-reference

ath:AT1G69040

ath:AT1G76990

ath:AT2G03730

ath:AT3G01990

ath:AT5G25320

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.451

Rank 1 · LXL04_032376 · OH-1004

Nucleus0.408

Rank 2 · LXL04_032376 · OH-1004

Cell membrane0.136

Rank 3 · LXL04_032376 · OH-1004

Lysosome / Vacuole0.063

Rank 4 · LXL04_032376 · OH-1004

Endoplasmic reticulum0.049

Rank 5 · LXL04_032376 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24931.2ACT_ACR9_3rd27-101 aa

PF26956.1ACT_ACR_D134-108 aa

PF24914.2ACR10_N35-90 aa

PF01842.32ACT128-162 aa

PF24931.2ACT_ACR9_3rd279-362 aa

PF01842.32ACT370-416 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032376	`PF24931.2`	ACT_ACR9_3rd	27	101	6.8e-19	68.5
LXL04_032376	`PF26956.1`	ACT_ACR_D1	34	108	9.6e-47	157.5
LXL04_032376	`PF24914.2`	ACR10_N	35	90	1.1e-13	51.1
LXL04_032376	`PF01842.32`	ACT	128	162	1e-22	80.2
LXL04_032376	`PF24931.2`	ACT_ACR9_3rd	279	362	6.8e-19	68.5
LXL04_032376	`PF01842.32`	ACT	370	416	1e-22	80.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JWR0`	Arabidopsis thaliana	ACT domain-containing protein ACR2	55.070%	Swiss-Prot	strong database homology
`O49285`	Arabidopsis thaliana	ACT domain-containing protein ACR3	44.671%	Swiss-Prot	moderate database homology
`Q8LJW3`	Arabidopsis thaliana	ACT domain-containing protein ACR4	42.340%	Swiss-Prot	moderate database homology
`Q9SGA0`	Arabidopsis thaliana	ACT domain-containing protein ACR6	42.361%	Swiss-Prot	moderate database homology
`Q9ZPQ8`	Arabidopsis thaliana	ACT domain-containing protein ACR5	39.957%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card