LXL04_032367 | RubberDandelionOmics

Gene overview

LXL04_032367

Reference: OH-1004 Chr: Chr07 Coordinates: 21423631-21427073 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2490 bp · LXL04_032367|LXL04_032367|OH1004|cDNA

ATGGCCTCCAGCAAATCACAGTCACCGGCTAATGTAGACGAAGCAGCAGCAATGGCAGCATCAGCATACCCATACCCGTACACCGCCAATGTTGCCAATTTTGTATCCGTCAAGCTCACCGGCCACGAGATGTACCCGTTATGGAAGACACAGATGCTTTGTCTCATCGAAGGTCATGACATGCTTGGATTCATCGACGGCACACTCGAACCACCACCCGATACCAACCCCGACGCTGCTCAGTGGTGGCGGAGGTCCGA...

CDS

Download CDS FASTA

2490 bp · LXL04_032367|LXL04_032367|OH1004|CDS

ATGGCCTCCAGCAAATCACAGTCACCGGCTAATGTAGACGAAGCAGCAGCAATGGCAGCATCAGCATACCCATACCCGTACACCGCCAATGTTGCCAATTTTGTATCCGTCAAGCTCACCGGCCACGAGATGTACCCGTTATGGAAGACACAGATGCTTTGTCTCATCGAAGGTCATGACATGCTTGGATTCATCGACGGCACACTCGAACCACCACCCGATACCAACCCCGACGCTGCTCAGTGGTGGCGGAGGTCCGA...

Protein

Download Protein FASTA

829 aa · LXL04_032367|LXL04_032367|OH1004|PROTEIN

MASSKSQSPANVDEAAAMAASAYPYPYTANVANFVSVKLTGHEMYPLWKTQMLCLIEGHDMLGFIDGTLEPPPDTNPDAAQWWRRSDALLRGWILGSLSNDILTNIIGLKTAKDVWVKLESSYNSPTPEFSSPVVVKAEIDGGLIKTTATPHSRSLPVPIYRGVSQQMDLKGDSATSAADSKISSSLSRLSQGLERTILPEESWAESSPTPLSSDIAEITDSQQEPATKINAYLPLYKAALRGDWEDAQDFINQEPEAVT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032367`
TK1151 ID	TkA08G169910
OH-1004 ID	LXL04_032367
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	98.300
Protein coverage (%)	TK1151 100.000 / OH-1004 62.847 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032367

Location Chr07:21423631-21427073 (+)

Description Similar to ITN1: Ankyrin repeat-containing protein ITN1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g12360`	Involved in salt stress tolerance.	ITN1, a novel gene encoding an ankyrin-repeat protein that affects the ABA-mediated production of reactive oxygen species and is involved in salt-stress tolerance in Arabidopsis thaliana.2008 · DOI: 10.1111/j.1365-313x.2008.03614.x
`At4g02960`	Retrovirus-related Pol polyprotein from transposon RE2.	No verified direct reference in this release
`UniProt: Q94HW2`	Retrovirus-related Pol polyprotein from transposon RE1.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0837000`	Involved in salt stress tolerance.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032367 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000281 mitotic cytokinesis Biological Process

GO:0006310 DNA recombination Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0006508 proteolysis Biological Process

GO:0007009 plasma membrane organization Biological Process

GO:0007165 signal transduction Biological Process

GO:0007528 neuromuscular junction development Biological Process

GO:0009651 response to salt stress Biological Process

GO:0010628 positive regulation of gene expression Biological Process

GO:0010650 positive regulation of cell communication by electrical coupling Biological Process

GO:0010765 positive regulation of sodium ion transport Biological Process

GO:0010960 magnesium ion homeostasis Biological Process

KEGG gene cross-reference

ath:AT3G12360

dosa:Os01g0837000

rno:361833

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.853

Rank 1 · LXL04_032367 · OH-1004

Endoplasmic reticulum0.088

Rank 2 · LXL04_032367 · OH-1004

Cytoplasm0.074

Rank 3 · LXL04_032367 · OH-1004

Lysosome / Vacuole0.034

Rank 4 · LXL04_032367 · OH-1004

Nucleus0.033

Rank 5 · LXL04_032367 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14244.13Retrotran_gag_334-73 aa

PF14223.15Retrotran_gag_255-128 aa

PF12796.14Ank_2284-361 aa

PF13857.13Ank_5303-347 aa

PF13962.12PGG662-775 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032367	`PF14244.13`	Retrotran_gag_3	34	73	6.2e-07	29.8
LXL04_032367	`PF14223.15`	Retrotran_gag_2	55	128	3.9e-10	40.5
LXL04_032367	`PF12796.14`	Ank_2	284	361	2.7e-15	57.4
LXL04_032367	`PF13857.13`	Ank_5	303	347	2.4e-10	41.3
LXL04_032367	`PF13962.12`	PGG	662	775	9.7e-23	80.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C7A2`	Arabidopsis thaliana	Ankyrin repeat-containing protein ITN1	22.656%	Swiss-Prot	weak database homology
`Q9ZT94`	Arabidopsis thaliana	Retrovirus-related Pol polyprotein from transposon RE2	30.841%	Swiss-Prot	weak database homology
`Q94HW2`	Arabidopsis thaliana	Retrovirus-related Pol polyprotein from transposon RE1	28.972%	Swiss-Prot	weak database homology
`A2CIR5`	Oryza sativa subsp. japonica	Ankyrin repeat-containing protein NPR4	25.581%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card