LXL04_032310 | RubberDandelionOmics

Gene overview

LXL04_032310

Reference: OH-1004 Chr: Chr07 Coordinates: 20282096-20283859 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1113 bp · LXL04_032310|LXL04_032310|OH1004|cDNA

ATGAACATGTCTGAGCAAACCATATGCACCGTTCAATTCAATATATGTGTTCCAAAACCCGACGTTCTTTCACCGGAATCCGCCTCTATTGACGTCGTCTCCGTTTCCGATTCGCCAGTAAGCTACCCATCCACCATCAAAACCACCCTAGTGGTCCCCCCATCACCAAGATTCAACCCAAACATCCGATCTGGCAGCCACACAGACATCGGCCCCCGCAAATCAAACGAAGACGAACACATCCGGATCGATGACCTGTC...

CDS

Download CDS FASTA

1113 bp · LXL04_032310|LXL04_032310|OH1004|CDS

ATGAACATGTCTGAGCAAACCATATGCACCGTTCAATTCAATATATGTGTTCCAAAACCCGACGTTCTTTCACCGGAATCCGCCTCTATTGACGTCGTCTCCGTTTCCGATTCGCCAGTAAGCTACCCATCCACCATCAAAACCACCCTAGTGGTCCCCCCATCACCAAGATTCAACCCAAACATCCGATCTGGCAGCCACACAGACATCGGCCCCCGCAAATCAAACGAAGACGAACACATCCGGATCGATGACCTGTC...

Protein

Download Protein FASTA

370 aa · LXL04_032310|LXL04_032310|OH1004|PROTEIN

MNMSEQTICTVQFNICVPKPDVLSPESASIDVVSVSDSPVSYPSTIKTTLVVPPSPRFNPNIRSGSHTDIGPRKSNEDEHIRIDDLSSHLGDLYNWPLPSSFYAIFDGHGGSEAATFIKTHATKIFFQDSDLPQPPPPPHTAITDTFLKDLQLSHSKAFLLADQAIADECTISDYTGTTALTVFIIGTHIVIANAGDCRAVISRNGIAIPMSKDHRESCVEERKRVEELGGYFEDGYLNGELAVTRALGDWYMKSPAGSE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032310`
TK1151 ID	TkA08G165100
OH-1004 ID	LXL04_032310
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	93.000
Protein coverage (%)	TK1151 98.157 / OH-1004 61.622 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032310

Location Chr07:20282096-20283859 (+)

Description Similar to At1g48040: Probable protein phosphatase 2C 13

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g48040`	Probable protein phosphatase 2C 13.	No verified direct reference in this release
`At3g62260`	Probable protein phosphatase 2C 49.	No verified direct reference in this release
`At3g17250`	Probable protein phosphatase 2C 43.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0295700`	Probable protein phosphatase 2C 2.	No verified direct reference in this release
`Os05g0134200`	Probable protein phosphatase 2C 47.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032310 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007165 signal transduction Biological Process

GO:0009651 response to salt stress Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004722 protein serine/threonine phosphatase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G48040

ath:AT3G17250

ath:AT3G62260

dosa:Os01g0295700

dosa:Os05g0134200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.568

Rank 1 · LXL04_032310 · OH-1004

Cytoplasm0.488

Rank 2 · LXL04_032310 · OH-1004

Cell membrane0.082

Rank 3 · LXL04_032310 · OH-1004

Endoplasmic reticulum0.045

Rank 4 · LXL04_032310 · OH-1004

Mitochondrion0.037

Rank 5 · LXL04_032310 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00481.27PP2C71-330 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032310	`PF00481.27`	PP2C	71	330	5e-64	217.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LNF4`	Arabidopsis thaliana	Probable protein phosphatase 2C 13	53.374%	Swiss-Prot	strong database homology
`Q3EAF9`	Arabidopsis thaliana	Probable protein phosphatase 2C 49	53.797%	Swiss-Prot	strong database homology
`Q9LUU7`	Arabidopsis thaliana	Probable protein phosphatase 2C 43	49.573%	Swiss-Prot	moderate database homology
`Q9FYN7`	Oryza sativa subsp. japonica	Probable protein phosphatase 2C 2	50.829%	Swiss-Prot	strong database homology
`Q6AUQ4`	Oryza sativa subsp. japonica	Probable protein phosphatase 2C 47	54.799%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card