LXL04_032293 | RubberDandelionOmics

Gene overview

LXL04_032293

Reference: OH-1004 Chr: Chr07 Coordinates: 20016754-20019295 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1200 bp · LXL04_032293|LXL04_032293|OH1004|cDNA

ATGGGGATCATAGAAAGGATCAAGGAAATTGAAGCCGAAATGGCACGTACCCAGAAAAACAAAGCAACAGAATATCATTTGGGTCAGCTCAAGGCTAAGATAGCAAAGCTAAGGACACAACTATTGGAGCCACCTAAAGGTACTAGTGGAGCTGGAGAGGGTTTTGAGGTCACAAAATACGGGCATGGACGTGTAGCACTGATAGGATTTCCAAGTGTGGGAAAGTCAACACTGTTGACCATGCTAACGGGAACACATTC...

CDS

Download CDS FASTA

1200 bp · LXL04_032293|LXL04_032293|OH1004|CDS

ATGGGGATCATAGAAAGGATCAAGGAAATTGAAGCCGAAATGGCACGTACCCAGAAAAACAAAGCAACAGAATATCATTTGGGTCAGCTCAAGGCTAAGATAGCAAAGCTAAGGACACAACTATTGGAGCCACCTAAAGGTACTAGTGGAGCTGGAGAGGGTTTTGAGGTCACAAAATACGGGCATGGACGTGTAGCACTGATAGGATTTCCAAGTGTGGGAAAGTCAACACTGTTGACCATGCTAACGGGAACACATTC...

Protein

Download Protein FASTA

399 aa · LXL04_032293|LXL04_032293|OH1004|PROTEIN

MGIIERIKEIEAEMARTQKNKATEYHLGQLKAKIAKLRTQLLEPPKGTSGAGEGFEVTKYGHGRVALIGFPSVGKSTLLTMLTGTHSEAASYEFTTLTCIPGIIHYNDTKIQLLDLPGIIEGASEGKGRGRQVIAVSKSSDIVLMVLDASKSEGHRQILTKELEAVGLRLNKKPPQIYFKKKKTGGISFNSTMQLTHVDEKLCYQILHEYKIHNAEILFREDATVDDLIDVIEGNRKYMKCIYVYNKIDVVGIDDVDKLA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032293`
TK1151 ID	TkA08G163940
OH-1004 ID	LXL04_032293
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032293

Location Chr07:20016754-20019295 (-)

Description Similar to DRG1: Developmentally-regulated G-protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g17470`	Binds GDP and GTP, and has low GTPase activity.	Biochemical characterization of Arabidopsis developmentally regulated G-proteins (DRGs).2009 · DOI: 10.1016/j.pep.2009.05.009
`At1g72660`	Binds GDP and GTP, and has low GTPase activity.	Biochemical characterization of Arabidopsis developmentally regulated G-proteins (DRGs).2009 · DOI: 10.1016/j.pep.2009.05.009

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032293 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002181 cytoplasmic translation Biological Process

GO:0007165 signal transduction Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0010494 cytoplasmic stress granule Cellular Component

GO:0016020 membrane Cellular Component

GO:0031410 cytoplasmic vesicle Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G17470

ath:AT1G72660

bta:507472

hsa:1819

mmu:13495

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.789

Rank 1 · LXL04_032293 · OH-1004

Nucleus0.264

Rank 2 · LXL04_032293 · OH-1004

Endoplasmic reticulum0.062

Rank 3 · LXL04_032293 · OH-1004

Cell membrane0.061

Rank 4 · LXL04_032293 · OH-1004

Mitochondrion0.055

Rank 5 · LXL04_032293 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01926.30MMR_HSR164-181 aa

PF02421.25FeoB_N64-159 aa

PF16897.11MMR_HSR1_Xtn184-289 aa

PF02824.28TGS290-366 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032293	`PF01926.30`	MMR_HSR1	64	181	2.3e-24	86.4
LXL04_032293	`PF02421.25`	FeoB_N	64	159	1.3e-12	48.3
LXL04_032293	`PF16897.11`	MMR_HSR1_Xtn	184	289	3.1e-42	143.6
LXL04_032293	`PF02824.28`	TGS	290	366	7.9e-22	77.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LQK0`	Arabidopsis thaliana	Developmentally-regulated G protein 1	89.196%	Swiss-Prot	strong database homology
`Q9CAI1`	Arabidopsis thaliana	Developmentally-regulated G protein 2	88.722%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card