RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_032050
Reference: OH-1004 Chr: Chr07 Coordinates: 15631119-15639231 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

4029 bp · LXL04_032050|LXL04_032050|OH1004|cDNA

ATGCTGGATTCATCATTGAATTTTTGGGACAAGTTGAAGGTGGGACTACACTATTTTGGCATGATGGCTTTTAGAAAATTTTGTAACCACTATTTAACACACATTCATGCACCACACATCAAATGTTTTACATTCCGCATTACATATCTCTGTACAAAGCCATCATTACCTAGTACAATGAAGTATTGGGCTTTGAGTATTCATAACTCATGGTTATATTGTACGTTGATGCTGATGGTGATACATATTCTTATGTTTGG...

CDS

Download CDS FASTA

4029 bp · LXL04_032050|LXL04_032050|OH1004|CDS

ATGCTGGATTCATCATTGAATTTTTGGGACAAGTTGAAGGTGGGACTACACTATTTTGGCATGATGGCTTTTAGAAAATTTTGTAACCACTATTTAACACACATTCATGCACCACACATCAAATGTTTTACATTCCGCATTACATATCTCTGTACAAAGCCATCATTACCTAGTACAATGAAGTATTGGGCTTTGAGTATTCATAACTCATGGTTATATTGTACGTTGATGCTGATGGTGATACATATTCTTATGTTTGG...

Protein

Download Protein FASTA

1342 aa · LXL04_032050|LXL04_032050|OH1004|PROTEIN

MLDSSLNFWDKLKVGLHYFGMMAFRKFCNHYLTHIHAPHIKCFTFRITYLCTKPSLPSTMKYWALSIHNSWLYCTLMLMVIHILMFGQTQGNCTEEERKALLEIKASYMKSHDSEIDNFLPTWVDYGGSTLEDDGSDCCDWERVTCNTTTGHVIDLSLYKLRGLDTYNGYGSNLWALNVSLFLHFNELTSLSLSDDFIDKKTMQTGLENLKKLEVLDLSFNYDVGNDILQSFKTLTSLKILDLSHTSLNGYFPISELSHL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_032050
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_032050
LocationChr07:15631119-15639231 (-)
DescriptionSimilar to RLP1: Receptor-like protein 1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g07390 Involved in plant defense.
The receptor-like protein ReMAX of Arabidopsis detects the microbe-associated molecular pattern eMax from Xanthomonas.2013 · DOI: 10.1105/tpc.113.110833
Perception of the novel MAMP eMax from different Xanthomonas species requires the Arabidopsis receptor-like protein ReMAX and the receptor kinase SOBIR.2013 · DOI: 10.4161/psb.27408
At1g74170 Receptor-like protein 13. No verified direct reference in this release
At2g25470 Receptor like protein 21. No verified direct reference in this release
At5g49290 Receptor-like protein 56. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_032050 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0002218 activation of innate immune response Biological Process
GO:0002242 defense response to parasitic plant Biological Process
GO:0002752 cell surface pattern recognition receptor signaling pathway Biological Process
GO:0002768 immune response-regulating cell surface receptor signaling pathway Biological Process
GO:0007165 signal transduction Biological Process
GO:0009626 plant-type hypersensitive response Biological Process
GO:0042742 defense response to bacterium Biological Process
GO:0045087 innate immune response Biological Process
GO:0051606 detection of stimulus Biological Process
GO:0140426 pathogen-associated molecular pattern receptor signaling pathway Biological Process
GO:0005576 extracellular region Cellular Component
GO:0005739 mitochondrion Cellular Component
KEGG gene cross-reference
ath:AT1G07390
ath:AT1G74170
ath:AT2G25470
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.846
Rank 1 · LXL04_032050 · OH-1004
Endoplasmic reticulum0.103
Rank 2 · LXL04_032050 · OH-1004
Cytoplasm0.063
Rank 3 · LXL04_032050 · OH-1004
Nucleus0.048
Rank 4 · LXL04_032050 · OH-1004
Lysosome / Vacuole0.030
Rank 5 · LXL04_032050 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08263.18LRRNT_296-147 aa
PF23598.2LRR_14187-326 aa
PF13855.13LRR_8212-273 aa
PF12799.14LRR_4236-279 aa
PF13855.13LRR_8335-394 aa
PF23598.2LRR_14335-544 aa
PF13855.13LRR_8359-418 aa
PF13855.13LRR_8408-468 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_032050PF08263.18LRRNT_2961476.1e-0936.7
LXL04_032050PF23598.2LRR_141873261.5e-2797.0
LXL04_032050PF13855.13LRR_82122739e-50167.0
LXL04_032050PF12799.14LRR_42362791e-31109.0
LXL04_032050PF13855.13LRR_83353949e-50167.0
LXL04_032050PF23598.2LRR_143355441.5e-2797.0
LXL04_032050PF13855.13LRR_83594189e-50167.0
LXL04_032050PF13855.13LRR_84084689e-50167.0
LXL04_032050PF13855.13LRR_85856459e-50167.0
LXL04_032050PF12799.14LRR_45856191e-31109.0
LXL04_032050PF13855.13LRR_87778369e-50167.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9LNV9Arabidopsis thalianaReceptor-like protein 137.214%Swiss-Protmoderate database homology
Q9C6A6Arabidopsis thalianaReceptor-like protein 1337.326%Swiss-Protmoderate database homology
Q9SKK2Arabidopsis thalianaReceptor like protein 2134.935%Swiss-Protmoderate database homology
F4K4T3Arabidopsis thalianaReceptor-like protein 5635.444%Swiss-Protmoderate database homology

JBrowse

View in Genome Browser