LXL04_032040 | RubberDandelionOmics

Gene overview

LXL04_032040

Reference: OH-1004 Chr: Chr07 Coordinates: 15411932-15415074 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1509 bp · LXL04_032040|LXL04_032040|OH1004|cDNA

ATGGTCATATTTCAGATTTCAACACATGGAAGAGCCAGTGTTGCAAAAGGGGGGGATTTGTGTATGAATCGAAGATGGGTCGAGCATGATCCGATGGAGATTCTTGAAAGTGTGAAAACTTGCATAACGAAGGCCGTTAGTAAAGCTACGGCTGATGGGTTTAATGTCGATAATGGTCTTAAAGCAATTGGTATTACTAATCAGAGGGAAACTACTGTGGTTTGGAGCAAGTCTACGGGGGCTGCTCTTTATAACGCCAT...

CDS

Download CDS FASTA

1509 bp · LXL04_032040|LXL04_032040|OH1004|CDS

ATGGTCATATTTCAGATTTCAACACATGGAAGAGCCAGTGTTGCAAAAGGGGGGGATTTGTGTATGAATCGAAGATGGGTCGAGCATGATCCGATGGAGATTCTTGAAAGTGTGAAAACTTGCATAACGAAGGCCGTTAGTAAAGCTACGGCTGATGGGTTTAATGTCGATAATGGTCTTAAAGCAATTGGTATTACTAATCAGAGGGAAACTACTGTGGTTTGGAGCAAGTCTACGGGGGCTGCTCTTTATAACGCCAT...

Protein

Download Protein FASTA

502 aa · LXL04_032040|LXL04_032040|OH1004|PROTEIN

MVIFQISTHGRASVAKGGDLCMNRRWVEHDPMEILESVKTCITKAVSKATADGFNVDNGLKAIGITNQRETTVVWSKSTGAALYNAIVWMDNRTTSICRKLEKELSGGKTHFVESCGLPISTYFSALKLLWLLENVDAVKSAVEKGDALFGTIDSWLIWNLTGGIDNGVHVTDVSNASRTMLMNLKTLNWDESTLKTLNIPKSILPKIVSNSEVIGHIGKKWVIPGIPISGCLGDQHAAMLGQSCRKGEAKSTYGTGAFI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032040`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032040

Location Chr07:15411932-15415074 (-)

Description Similar to GLPK: Glycerol kinase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g80460`	Key enzyme in the regulation of glycerol uptake and metabolism.	Arabidopsis NHO1 is required for general resistance against Pseudomonas bacteria.2001 · DOI: 10.1105/tpc.13.2.437 Interplay of the Arabidopsis nonhost resistance gene NHO1 with bacterial virulence.2003 · DOI: 10.1073/pnas.0637377100 Glycerol-insensitive Arabidopsis mutants: gli1 seedlings lack glycerol kinase, accumulate glycerol and are more resistant to abiotic stress.2004 · DOI: 10.1111/j.1365-313x.2003.01989.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032040 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002237 response to molecule of bacterial origin Biological Process

GO:0006071 glycerol metabolic process Biological Process

GO:0006072 glycerol-3-phosphate metabolic process Biological Process

GO:0006641 triglyceride metabolic process Biological Process

GO:0009617 response to bacterium Biological Process

GO:0010188 response to microbial phytotoxin Biological Process

GO:0019563 glycerol catabolic process Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0046167 glycerol-3-phosphate biosynthetic process Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0004370 glycerol kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G80460

cmi:CMM_1831

mra:MRA_3731

mtc:MT3798

mtu:Rv3696c

mtv:RVBD_3696c

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.683

Rank 1 · LXL04_032040 · OH-1004

Nucleus0.227

Rank 2 · LXL04_032040 · OH-1004

Peroxisome0.112

Rank 3 · LXL04_032040 · OH-1004

Mitochondrion0.090

Rank 4 · LXL04_032040 · OH-1004

Cell membrane0.041

Rank 5 · LXL04_032040 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00370.28FGGY_N24-242 aa

PF02782.23FGGY_C251-449 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032040	`PF00370.28`	FGGY_N	24	242	1.2e-58	199.4
LXL04_032040	`PF02782.23`	FGGY_C	251	449	7.4e-44	150.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M8L4`	Arabidopsis thaliana	Glycerol kinase	81.761%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card