LXL04_031935 | RubberDandelionOmics

Gene overview

LXL04_031935

Reference: OH-1004 Chr: Chr07 Coordinates: 13461212-13465384 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3198 bp · LXL04_031935|LXL04_031935|OH1004|cDNA

ATGGCGTTTGCTACACCAACCAACACGTTTAAGAAACCCCCGCCTTATTTCTGGTATTGTCATTCATGCCCTCGCTCTACTACTTCCATAGTggcatcttcttcttcttcttgccGGTCTATGTGGAGTTCTGATACCAGCAAGTCCCCTTACAGGTGGAAAGTTCAAAATCTTCATAACACAAAAGACCGTTTTTGCAACATCTCCATGGCTCTTAATCCATTTGGATTCAACACATGGTCAAACTTTACCACAATGTC...

CDS

Download CDS FASTA

3198 bp · LXL04_031935|LXL04_031935|OH1004|CDS

ATGGCGTTTGCTACACCAACCAACACGTTTAAGAAACCCCCGCCTTATTTCTGGTATTGTCATTCATGCCCTCGCTCTACTACTTCCATAGTGGCATCTTCTTCTTCTTCTTGCCGGTCTATGTGGAGTTCTGATACCAGCAAGTCCCCTTACAGGTGGAAAGTTCAAAATCTTCATAACACAAAAGACCGTTTTTGCAACATCTCCATGGCTCTTAATCCATTTGGATTCAACACATGGTCAAACTTTACCACAATGTC...

Protein

Download Protein FASTA

1065 aa · LXL04_031935|LXL04_031935|OH1004|PROTEIN

MAFATPTNTFKKPPPYFWYCHSCPRSTTSIVASSSSSCRSMWSSDTSKSPYRWKVQNLHNTKDRFCNISMALNPFGFNTWSNFTTMSFNERPRYPNSRNNQSHADFRLLVVESKSGISYARMVPHGSKDGIQGNTCITPVLDTHPQTPWIQAREALKATKEDTCVANKVTFSVPNIPNPPNIPNLPNVPKVQYAGSVITEPIQHENMQVPLKKAQTMSPQTQGQKIPQKYPENTHVNGVQKKELKLEKPKLEDLNETYIV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_031935`
TK1151 ID	TkA08G137270
OH-1004 ID	LXL04_031935
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_031935

Location Chr07:13461212-13465384 (-)

Description Similar to POLIB: DNA polymerase I B, chloroplastic/mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g20540`	In addition to polymerase activity, this DNA polymerase exhibits 5'-3' exonuclease activity (By similarity).	Divergent roles for the two PolI-like organelle DNA polymerases of Arabidopsis.2011 · DOI: 10.1104/pp.111.173849
`At1g50840`	In addition to polymerase activity, this DNA polymerase exhibits 5'-3' exonuclease activity (By similarity).	Divergent roles for the two PolI-like organelle DNA polymerases of Arabidopsis.2011 · DOI: 10.1104/pp.111.173849 Arabidopsis thaliana organellar DNA polymerase IB mutants exhibit reduced mtDNA levels with a decrease in mitochondrial area density.2013 · DOI: 10.1111/ppl.12009

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0175300`	In addition to polymerase activity, this DNA polymerase exhibits 5'-3' exonuclease activity (By similarity).	No verified direct reference in this release
`Os08g0175600`	In addition to polymerase activity, this DNA polymerase exhibits 5'-3' exonuclease activity.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031935 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006261 DNA-templated DNA replication Biological Process

GO:0006264 mitochondrial DNA replication Biological Process

GO:0006302 double-strand break repair Biological Process

GO:0033259 plastid DNA replication Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0042644 chloroplast nucleoid Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0003887 DNA-directed DNA polymerase activity Molecular Function

GO:0008408 3'-5' exonuclease activity Molecular Function

GO:0008409 5'-3' exonuclease activity Molecular Function

KEGG gene cross-reference

ath:AT1G50840

ath:AT3G20540

dosa:Os08g0175300

dosa:Os08g0175600

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.841

Rank 1 · LXL04_031935 · OH-1004

Mitochondrion0.123

Rank 2 · LXL04_031935 · OH-1004

Cytoplasm0.077

Rank 3 · LXL04_031935 · OH-1004

Nucleus0.063

Rank 4 · LXL04_031935 · OH-1004

Peroxisome0.036

Rank 5 · LXL04_031935 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01612.27DNA_pol_A_exo1348-512 aa

PF00476.27DNA_pol_A730-859 aa

PF00476.27DNA_pol_A880-1062 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_031935	`PF01612.27`	DNA_pol_A_exo1	348	512	7.7e-11	42.8
LXL04_031935	`PF00476.27`	DNA_pol_A	730	859	3.3e-76	257.4
LXL04_031935	`PF00476.27`	DNA_pol_A	880	1062	3.3e-76	257.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84ND9`	Arabidopsis thaliana	DNA polymerase I B, chloroplastic/mitochondrial	70.552%	Swiss-Prot	strong database homology
`F4I6M1`	Arabidopsis thaliana	DNA polymerase I A, chloroplastic/mitochondrial	67.654%	Swiss-Prot	strong database homology
`Q6Z4T5`	Oryza sativa subsp. japonica	DNA polymerase I A, chloroplastic	66.832%	Swiss-Prot	strong database homology
`Q6Z4T3`	Oryza sativa subsp. japonica	DNA polymerase I B, mitochondrial	65.686%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card