LXL04_031313 | RubberDandelionOmics

Gene overview

LXL04_031313

Reference: OH-1004 Chr: Chr07 Coordinates: 4450817-4456030 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1095 bp · LXL04_031313|LXL04_031313|OH1004|cDNA

ATGACATTTGCTTTAAACACTGATGGTTTACCAAACAACAACAATGACCAAGAAGGCCCAACGGGCCTGGGCCTGGGCCAAACAAGATTGGGCCGTTTAGTGAGTGCAAGTGGGAGACAGCTATTGGATAAACTAAACTCAGCTAGAAAGAACTTCCCAATGAAGGTGTTTCTTCTACTCCTTGGTTTCTATACTGCAAATGCATTAGCTACAATTCTAGGGCAAACTGGAGATTGGGATGTTTTGGTTGCGGGTGTAGT...

CDS

Download CDS FASTA

1095 bp · LXL04_031313|LXL04_031313|OH1004|CDS

ATGACATTTGCTTTAAACACTGATGGTTTACCAAACAACAACAATGACCAAGAAGGCCCAACGGGCCTGGGCCTGGGCCAAACAAGATTGGGCCGTTTAGTGAGTGCAAGTGGGAGACAGCTATTGGATAAACTAAACTCAGCTAGAAAGAACTTCCCAATGAAGGTGTTTCTTCTACTCCTTGGTTTCTATACTGCAAATGCATTAGCTACAATTCTAGGGCAAACTGGAGATTGGGATGTTTTGGTTGCGGGTGTAGT...

Protein

Download Protein FASTA

364 aa · LXL04_031313|LXL04_031313|OH1004|PROTEIN

MTFALNTDGLPNNNNDQEGPTGLGLGQTRLGRLVSASGRQLLDKLNSARKNFPMKVFLLLLGFYTANALATILGQTGDWDVLVAGVVVAAIEGIGMLMYKKSNSKSSCFESPLQYKEEDKYQKNVFQVMDSLLSSEGDSQRTQYPYVTGTSVIGIKYKDGVLMAADMGGSYGSTIRYKSVERMKQVGKHSLLGASGEISDFQEILRYLDDLILNDSMWDDGNSHGPKQVHNYLTRVMYNRRNKFDPLWNSLIIGGVKNGE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_031313`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_031313

Location Chr07:4450817-4456030 (+)

Description Similar to PBG1: Proteasome subunit beta type-4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g56450`	Non-catalytic component of the proteasome, a multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031313 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002376 immune system process Biological Process

GO:0006281 DNA repair Biological Process

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0006974 DNA damage response Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0007283 spermatogenesis Biological Process

GO:0010498 proteasomal protein catabolic process Biological Process

GO:0010499 proteasomal ubiquitin-independent protein catabolic process Biological Process

GO:0030317 flagellated sperm motility Biological Process

GO:0032743 positive regulation of interleukin-2 production Biological Process

GO:0032760 positive regulation of tumor necrosis factor production Biological Process

GO:0034341 response to type II interferon Biological Process

KEGG gene cross-reference

ath:AT1G56450

bta:506203

hsa:5692

mmu:19172

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.769

Rank 1 · LXL04_031313 · OH-1004

Mitochondrion0.127

Rank 2 · LXL04_031313 · OH-1004

Cytoplasm0.069

Rank 3 · LXL04_031313 · OH-1004

Endoplasmic reticulum0.057

Rank 4 · LXL04_031313 · OH-1004

Nucleus0.052

Rank 5 · LXL04_031313 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04483.18DUF56575-109 aa

PF00227.32Proteasome148-331 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_031313	`PF04483.18`	DUF565	75	109	1.7e-08	35.5
LXL04_031313	`PF00227.32`	Proteasome	148	331	1.9e-34	119.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q7DLR9`	Arabidopsis thaliana	Proteasome subunit beta type-4	80.000%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card