LXL04_031047 | RubberDandelionOmics

Gene overview

LXL04_031047

Reference: OH-1004 Chr: Chr06 Coordinates: 127222197-127224922 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1407 bp · LXL04_031047|LXL04_031047|OH1004|cDNA

ATGTCTCTGGGCTACGCAGAGAAGCTTTCTTACATAGAGGATGTTGGCAATGTCGGAATGACTGAAATTTTTGATCCACCTCGCATCTTACAAGAGAAGATTGAGAGGCTTACAATGATGATTCGCAAGAGTAAGCATTTAGTTGTGTTTACTGGAGCTGGTATATCAACTTCTTGTGGTATACCTGATTTTCGTGGGCCCACAGGGATTTGGACACTTCAGAAGGGAGGCAATTCCTTGCCAGAAGCATCACTCCCATT...

CDS

Download CDS FASTA

1407 bp · LXL04_031047|LXL04_031047|OH1004|CDS

ATGTCTCTGGGCTACGCAGAGAAGCTTTCTTACATAGAGGATGTTGGCAATGTCGGAATGACTGAAATTTTTGATCCACCTCGCATCTTACAAGAGAAGATTGAGAGGCTTACAATGATGATTCGCAAGAGTAAGCATTTAGTTGTGTTTACTGGAGCTGGTATATCAACTTCTTGTGGTATACCTGATTTTCGTGGGCCCACAGGGATTTGGACACTTCAGAAGGGAGGCAATTCCTTGCCAGAAGCATCACTCCCATT...

Protein

Download Protein FASTA

468 aa · LXL04_031047|LXL04_031047|OH1004|PROTEIN

MSLGYAEKLSYIEDVGNVGMTEIFDPPRILQEKIERLTMMIRKSKHLVVFTGAGISTSCGIPDFRGPTGIWTLQKGGNSLPEASLPFHRAMPSMTHMALVELERAGILKFVISQNIDGLHLRSGIPREKLSELHGNSFMERCSSCGVEYFRDFEVESVGLKETSRRCSNGDCDVKLKDTVLDWEDALPPEEMNPAEVHCEKADVVLCLGTSLQITPACNLPLKCLRGGGKVVIVNLQKTPKDKKASMVIHGFVDKVIGGI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_031047`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_031047

Location Chr06:127222197-127224922 (+)

Description Similar to SRT1: NAD-dependent protein deacetylase SRT1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g55760`	NAD-dependent protein deacetylase (By similarity).	Histone Deacetylases SRT1 and SRT2 Interact with ENAP1 to Mediate Ethylene-Induced Transcriptional Repression.2018 · DOI: 10.1105/tpc.17.00671

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0271000`	NAD-dependent protein deacetylase.	No verified direct reference in this release
`UniProt: B8ARK7`	NAD-dependent protein deacetylase.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031047 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0006302 double-strand break repair Biological Process

GO:0006606 protein import into nucleus Biological Process

GO:0008340 determination of adult lifespan Biological Process

GO:0009411 response to UV Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0010526 transposable element silencing Biological Process

GO:0010569 regulation of double-strand break repair via homologous recombination Biological Process

GO:0019216 regulation of lipid metabolic process Biological Process

GO:0031508 pericentric heterochromatin formation Biological Process

GO:0031509 subtelomeric heterochromatin formation Biological Process

GO:0031648 protein destabilization Biological Process

KEGG gene cross-reference

ath:AT5G55760

dosa:Os04g0271000

osa:4335342

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.635

Rank 1 · LXL04_031047 · OH-1004

Cytoplasm0.321

Rank 2 · LXL04_031047 · OH-1004

Mitochondrion0.086

Rank 3 · LXL04_031047 · OH-1004

Cell membrane0.046

Rank 4 · LXL04_031047 · OH-1004

Endoplasmic reticulum0.034

Rank 5 · LXL04_031047 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02146.24SIR252-73 aa

PF02146.24SIR287-216 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_031047	`PF02146.24`	SIR2	52	73	4.1e-28	99.2
LXL04_031047	`PF02146.24`	SIR2	87	216	4.1e-28	99.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FE17`	Arabidopsis thaliana	NAD-dependent protein deacetylase SRT1	65.474%	Swiss-Prot	strong database homology
`Q7XWV4`	Oryza sativa subsp. japonica	NAD-dependent protein deacetylase SRT1	59.341%	Swiss-Prot	strong database homology
`B8ARK7`	Oryza sativa subsp. indica	NAD-dependent protein deacetylase SRT1	59.121%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card