LXL04_030863 | RubberDandelionOmics

Gene overview

LXL04_030863

Reference: OH-1004 Chr: Chr06 Coordinates: 124277407-124279273 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

738 bp · LXL04_030863|LXL04_030863|OH1004|cDNA

ATGGTATATGATTTGGTATCTGATTTCTTGCATTGCTGCATTGATTCAGGTGAAACTCCTCTTATTCAAGCTGCAAGACAATCACATACTTCCACTGCCAAATATCTTATTGAACATGGTGCTAATCCTGCACTTGCAAGTGAATTAGGAGCTACAGCTCTACATCATGTTGTTGGAACAGGTGACATTGAGTTGATGGAGGCTTTGCTGTCCACTGGTGTTGAAGTTGATTCACAAAGTGATGCTGGTACACCACTTGT...

CDS

Download CDS FASTA

738 bp · LXL04_030863|LXL04_030863|OH1004|CDS

ATGGTATATGATTTGGTATCTGATTTCTTGCATTGCTGCATTGATTCAGGTGAAACTCCTCTTATTCAAGCTGCAAGACAATCACATACTTCCACTGCCAAATATCTTATTGAACATGGTGCTAATCCTGCACTTGCAAGTGAATTAGGAGCTACAGCTCTACATCATGTTGTTGGAACAGGTGACATTGAGTTGATGGAGGCTTTGCTGTCCACTGGTGTTGAAGTTGATTCACAAAGTGATGCTGGTACACCACTTGT...

Protein

Download Protein FASTA

245 aa · LXL04_030863|LXL04_030863|OH1004|PROTEIN

MVYDLVSDFLHCCIDSGETPLIQAARQSHTSTAKYLIEHGANPALASELGATALHHVVGTGDIELMEALLSTGVEVDSQSDAGTPLVWASGHGQQDALKLLLKHKADAGGKVNITAGGATPLHVAADIGNSELITCLLKSGADPNVINEEDWKSVQVATLRGNRGAVEVLFPVSSHVETIPKWSVDGIIQYMQSEGSKNQKFEEAANAFYEGVKLDPENKELVHAFREAIDAGRAFHGTKNDNEK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030863`
TK1151 ID	TkAUNG022570
OH-1004 ID	LXL04_030863
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	79.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_030863`
Location	Chr06:124277407-124279273 (+)
Description	Similar to ASB2: Ankyrin repeat and SOCS box protein 2
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_030863` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006511 ubiquitin-dependent protein catabolic process Biological Process GO:0006887 exocytosis Biological Process GO:0006888 endoplasmic reticulum to Golgi vesicle-mediated transport Biological Process GO:0007010 cytoskeleton organization Biological Process GO:0007165 signal transduction Biological Process GO:0014732 skeletal muscle atrophy Biological Process GO:0016567 protein ubiquitination Biological Process GO:0030036 actin cytoskeleton organization Biological Process GO:0035556 intracellular signal transduction Biological Process GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process GO:0045199 maintenance of epithelial cell apical/basal polarity Biological Process GO:0071800 podosome assembly Biological Process
KEGG gene cross-reference	bta:539244 hsa:286 hsa:51676 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.632

Rank 1 · LXL04_030863 · OH-1004

Nucleus0.377

Rank 2 · LXL04_030863 · OH-1004

Mitochondrion0.068

Rank 3 · LXL04_030863 · OH-1004

Cell membrane0.046

Rank 4 · LXL04_030863 · OH-1004

Endoplasmic reticulum0.045

Rank 5 · LXL04_030863 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12796.14Ank_214-79 aa

PF00023.37Ank17-44 aa

PF13637.13Ank_422-70 aa

PF12796.14Ank_249-108 aa

PF12796.14Ank_286-171 aa

PF13637.13Ank_486-138 aa

PF00023.37Ank118-148 aa

PF13606.13Ank_3118-146 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030863	`PF12796.14`	Ank_2	14	79	2.2e-30	105.8
LXL04_030863	`PF00023.37`	Ank	17	44	4.4e-26	90.2
LXL04_030863	`PF13637.13`	Ank_4	22	70	6.2e-22	77.9
LXL04_030863	`PF12796.14`	Ank_2	49	108	2.2e-30	105.8
LXL04_030863	`PF12796.14`	Ank_2	86	171	2.2e-30	105.8
LXL04_030863	`PF13637.13`	Ank_4	86	138	6.2e-22	77.9
LXL04_030863	`PF00023.37`	Ank	118	148	4.4e-26	90.2
LXL04_030863	`PF13606.13`	Ank_3	118	146	7.7e-20	69.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card